MMM#17: Review of the Blog in 2022

Another year has come and gone which means it’s time to look back at what has happened in the last 12 months with this blog and what I want to do with it in future.

To say that this year has been eventful would be an understatement. In the UK, we’ve have had three prime ministers and witnessed the death of our longest reigning monarch and elsewhere we have seen war come to Europe again through Russia’s invasion of Ukraine. In the US, Donald Trump has relaunched another Presidential campaign and Elon Musk has taken over Twitter.

In the more mundane world of this blog, I set myself some targets at the end of 2021 and unfortunately I didn’t do too well! I think it was a case of biting more than I could chew. I have looked back on the targets I set and, even though I didn’t achieve most of them, I want to look at how well I did on each one.

Regular posts

I had a target of doing two posts every month this year but I only managed to do this between January to March. Although I managed to post at least once a month, I struggled to get a post finished before the month was out on a few occasions so I think this target was a hindrance rather than a help. Although I still want to post regularly, I’m not going to bother trying to post every month next year. Ideally I want to get to a point where I have enough writing to post more often. I’m not going to post anything next month and instead have a little break from writing.

More book reviews

My target this year was to read and write a review for five books but I only managed two and I’m still reading the books I had planned to review this year! I’m pleased overall with the reviews I did during the last 12 months although they were probably too long and detailed than they needed to be and it was often very draining writing them. Believe it or not, those reviews were even longer before I edited them. I’m still going to write reviews in the future but I want to try to make them more concise.

More videos (eventually)

I completely failed in this goal and I still don’t know when or if I’ll get round to making any videos at the moment. Next year I want to at least think more about this than I did in 2022.

And other things

This is the only target that I had any success with as I managed to write about other subjects such as films alongside my usual content. I have more ideas what I want to write about but I still have to work on a lot of them. I managed to redesign the layout of this blog as well and I’m happy with how it looks at the moment.

A bigger audience

I also failed on this front although I could have done more to promote my posts such as using Twitter. However, I don’t like to use that platform too much and I like having time away from political stuff – on the internet at least. Using Twitter more would mean I’d spend more time on there than I want to. Like my idea of making videos, how I could get a bigger audience is something I should try to think about more in future.

Instead of making more goals, my target next year is to just keep doing what I’m doing but keep trying to improve things. Happy New Year!

MMM#16: Elon Musk and Twitter/’She Said’ Flops/Qatar World Cup

Musk and Twitter

I try not to go on Twitter that much and restrict the time I spend there to once a week but I’m enjoying the drama that is unfolding following Elon Musk’s acquisition of the site earlier this year. Musk has reinstated accounts such as Donald Trump, Jordan Peterson, Kanye West and Carl Benjamin – a.k.a. Sargon of Akkad – much to the chagrin of many establishment figures.

Despite now being back on Twitter, Trump has not returned and instead remained on his Truth Social account. Musk reminds me a lot of Trump particularly during the latter’s Presidency as Musk has the same chaotic energy that drives many people insane.

Musk has compared Twitter to a town square but, as I argued in a post last year, Twitter – and the internet as a whole – can more accurately be described as a hybrid between public and private spaces since we can interact with complete strangers in the comfort of our own homes. Similarly, people interact with each other on Twitter either using their real names and photos or – like myself – behind a false name and image. This obviously makes the task of managing a major social media site such as Twitter hard to handle.

The question of which individuals to allow on the site and which to prevent is inevitably going to be one that Musk and his staff at Twitter will have to deal with for the foreseeable future. One solution I thought of was to allow those who use their real name and faces to have free rein over what they can say with anonymous accounts given less freedoms in comparison. There would still be a debate here however over what constitutes a banning or restriction.

Predictably, Musk’s actions have led to opponents arguing that hate speech will become more commonplace on the site. By ‘hate speech’ presumably they mean primarily ‘speech which we personally dislike or disagree with’. There has also been the suggestion that Twitter under the helm of Elon Musk is crashing and burning due to Musk’s eccentricity and hubris.

There is also likely some wishful thinking going on in the sense that people are predicting the demise of Twitter due to Musk’s mass firing of its staff and his admission that the site has various debt problems. The counterargument to this is that Musk’s reinstation of various accounts will increase interest in the site and result in more people creating accounts.

Despite various famous people claiming that they are going to leave Twitter, for the time being Twitter remains the go-to social media site for the rich and powerful. I can’t see an alternative equivalent to Twitter emerging any time soon which will culminate in a mass exodus of celebrities and establishment figures who can’t comprehend that other people don’t share their worldview. Many people announced they would leave the United States if Trump became President only to remain when Trump was elected.

The current talk around Twitter reminds me a little of the sneering criticisms that followed the launch of the GB News channel last year. In the channel’s first few months, it faced technical difficulties, disagreements over the channel’s political leanings and a rotating door of presenters joining and leaving with many people concluding that the channel would ultimately fail. Following its teething problems, however, GB News has maintained a steady number of viewers along with established and experienced presenters. At the very least, it offers a slightly different take on current events and news which is not provided by other news networks, although I still prefer online content creators. Similar to Twitter, many mainstream commentators hoped GB News would fail because they didn’t like the type of political commentary it could offer.

My prediction, such as it is, is that Twitter is not going anywhere and Musk will eventually figure out how to make the site financially stable by subscription charges or some new features to the site. Musk has said that he will eventually step back from Twitter and let others run the site but I hope he will continue to stir up trouble to drive the establishment crazy.

It will be interesting to see what unfolds during Donald Trump’s 2024 Presidential campaign and if Trump will return to Twitter during the election which, at the time of writing, is still just under two years away. Considering how eventful 2022 has been we likely have a lot to go through before 2024 even comes around.

‘She Said’ Bombs at the Box Office

A film about two journalists investigating the sexual assault claims against Hollywood producer Harvey Weinstein called She Said, based on a book of the same name, has been released and has only taken $2.2 million from its opening weekend despite costing $32 million to make. This puts the film among the biggest flops in history.

Despite being lavished with praise by critics, it seems audiences didn’t want to see a film about the #MeToo movement which has already been shoved in their faces since the Harvey Weinstein controversy emerged in 2017. It’s also been pointed out that other films have already explored #MeToo such as Bombshell which was about accusations against Roger Ailes at Fox News. Even Weinstein himself, via a spokesman, has gloated at She Said‘s poor performance.

She Said could go down as the definitive example of the idea of ‘Get Woke, Go Broke’. The film critic Armond White wrote a good article here where he notes that the media thinks that it simply gives what audiences want when in reality it just assumes that its opinions are widely shared by the public and makes excuses when certain films fail.

I don’t support sexual harassment but I don’t support the #MeToo movement either so it’s tempting to think that She Said flopping is evidence of the public giving a middle finger to #MeToo. However, the underperformance of She Said is a pattern shared by other ‘awards contender’ films being released which has been partly explained by people being more reluctant to go to the cinema following the pandemic. It may also point to the declining interest in Hollywood films in general.

The domination of Marvel movies and streaming services means that there is less appetite for people to go to the cinema for films they can eventually watch on services like Netflix. Award ceremonies like the Oscars are also declining in relevance. Being a film geek, although I’ve never cared about watching the Oscar ceremony, I’ve always liked to know who the winners were. However, this year I completely forgot about the Oscars and was only aware that it had taken place because of Will Smith slapping Chris Rock. Also, most people couldn’t name the films that have won awards over the past few years.

Here’s hoping the failure of She Said is evidence that #MeToo is disappearing up its own backside.

World Cup – just woke bread and circuses?

At the time of writing, the FIFA World Cup is currently taking place in Qatar. Since FIFA announced that Qatar would host the 2022 tournament, it has been the subject of controversy due to the country’s lack of footballing prowess, human rights abuses and political views that are not shared by most Western countries.

There has also been pressure on teams like England to make a stand for LGBT rights and continue to ‘take a knee’ against racism. I like football, so I’ve just watched the matches and ignored most of the politicking happening around it. A lot of other people have boycotted the competition though due to these controversies.

Detractors on the right or people who are just anti-woke in general often disparage the World Cup as simply ‘bread and circuses’ for the masses or use the dismissive word ‘sportsball’ to describe it. The argument here is that such spectacles distract people from looking at deeper societal problems but I doubt that many people would suddenly become enlightened about the state of the world if sports tournaments ceased to exist. The internet is a massive source of information yet many people are content to watch cat videos or argue with complete strangers about absolutely anything.

It is true that football is ultimately pointless, many players are overpaid prima donnas and the sports industry can be very tacky and consumerist. Not everyone likes football and that’s fine. Nevertheless, criticisms about ‘sportsball’ can just as easily be made against the entertainment industry as a whole. Much like films – unless it’s She Said – people turn to sport as a way to forget about all the crap that’s happening in their lives. Ironically, the insertion of wokeness into sport and film does the complete opposite of that.

At the Movies with Mystery Man #1

Ed Wood (1994)

From time to time, I want to write about subjects other than issues relating to men although that will remain the focus of this blog. Also, the depressing state of current events has made me want to turn my attention to other things for a little bit.

I’ve always enjoyed cultural commentary such as film analysis and have wanted to write about certain films for a while but had hitherto not had an outlet for doing so. Since most artforms contain, or at least inspire, political commentary, talking about culture – even popular culture – is a useful way to explore how societies perceive themselves. I only hope this will be interesting to whoever happens to read it.

Since I’ve already written about Johnny Depp on this blog because of the Amber Heard trial earlier this year, I thought it would be appropriate to explore a Johnny Depp film first. The film in question is Ed Wood. It helps that I wrote most of what is written here years ago when I first got interested in writing but never did anything with it. Some of the content of the film is also relevant to subjects I’ve written about previously on this blog.  It is Halloween the day after I am posting this which is also appropriate given the film’s content.

Ed Wood was directed by Tim Burton and it is the second of his and Johnny Depp’s many collaborations. In my opinion, it is also Tim Burton’s best film but also one of his least known. While I wouldn’t consider it my favourite film, I would probably place it on a list of my all-time favourites. Admittedly, this is for entirely personal reasons rather than a belief that it is superior to other films in some way or another. I have an interest in old B-movies, particularly from the 1950s and 60s, which were often very bizarre, amateurish and have an interesting back story to how they were made, even if the films themselves are dull and unwatchable.

Ed Wood is a biopic about the film director Edward D. Wood Jr. (1924-1978) who is played by Johnny Depp and is often infamously credited with the title of ‘Worst Director of All Time.’ The film focuses on a period of Wood’s life in the 1950s where he made his most well-known films which are famous for their low-budget and flawed productions.

Many of these films starred the Hungarian actor Bela Lugosi (1882-1956) who was famous for playing Count Dracula in the 1930s but had become a has-been by the 1950s. Wood was a fan of Legosi’s movies and hoped he could capitalise on Legosi’s status as a legendary horror actor. Bela Lugosi is portrayed in the film by Martin Landau whose acclaimed performance earned him the Academy Award for Best Supporting Actor.

The production of three Ed Wood films is depicted in Ed Wood: Glen or Glenda (1953), Bride of the Monster (1955) and Plan 9 from Outer Space (1957). Wood made another film during this period called Jail Bait (1954) but this is never mentioned in Ed Wood. One reason for this is probably because Jail Bait does not feature Bela Lugosi whose relationship with Wood is central to Tim Burton’s film.

In addition to Bela Lugosi, the film also portrays some of Wood’s friends and associates who were key figures in his life during this period. These include Wood’s girlfriend Dolores Fuller (1923-2011) who is played by Sarah Jessica Parker (and you have to hand it to the filmmakers for getting Parker to say the line “do I really have a face like a horse?” at one point!),  John ‘Bunny’ Breckinridge (1903-1996), played by Bill Murray, Jeron Criswell King a.k.a. ‘The Amazing Criswell’ (1907-1982), played by Jeffrey Jones, Tor Johnson (1903-1971) played by professional wrestler George ‘The Animal’ Steele and Vampira (1922-2008), played by Lisa Marie. Most of these people would make several appearances in Wood’s films and became a kind of ‘band of misfits’ for Wood.

Ed Wood was filmed in black and white by cinematographer Stefan Czapsky to imitate the majority of films that would have been released in the 1950s and has a simplistic design again to portray the time period. In one scene the film plays on its lack of colour when the cinematographer for Bride of the Monster is asked whether a red dress or a green dress works better for his cameras and he says that he is colour-blind but that he prefers the “dark grey one”. The film was distributed by Touchstone Pictures which is a subsidiary of The Walt Disney Company where Tim Burton once worked as an animator.

The screenplay was written by Scott Alexander and Larry Karaszewski who went on to write other biopics about obscure figures such as The People vs. Larry Flynt about pornographic magazine publisher Larry Flynt and Man on the Moon about the comedian Andy Kaufman. More recently they wrote Big Eyes about the husband and wife painters Water and Margaret Keane and this was once again directed by Tim Burton. I prefer these kinds of biopics to ones of more famous figures because they bring to light interesting people that are not as familiar or well known to the general public. Ed Wood has elements in common with Man on the Moon because both films feature recreations of events that you would not believe happened such as Andy Kaufman’s unusual publicity stunts and Wood’s bizarre films until you saw the real thing.

A recurring theme in Ed Wood is the various methods Wood had to undertake to get his films made. For example, in order to get the director role for Glen or Glenda, Wood had to convince B-movie producer George Weiss that he was the ideal person to make Weiss’ film I Changed My Sex! which was supposed to capitalise on the recent sex change operation of Christine Jorgensen. Wood convinced George Weiss that he could make the film because he was able to get a cheap but recognisable star in the form of Bela Lugosi. Wood had previously tried to convince Weiss to let him to direct the sex change film by claiming that he had “special qualifications” because of his liking for wearing women’s clothing. Wood’s mother apparently wanted a daughter and so dressed Wood in girl’s clothes when he was a boy leading to him becoming a transvestite in his adulthood. When Wood is asked if he is a homosexual when he reveals his transvestism, he responds by claiming that cross-dressing makes him feel closer to women and was said to be a womaniser.

Instead of being about transexuals however, Glen or Glenda mainly relates to Wood’s transvestism and has a sex-change operation story tacked on near the end of the film called ‘Alan or Anne’. Wood stars as Glen in the film and is credited as ‘Daniel Davis’. Bela Lugosi stars in the film as a kind of scientist/narrator but his character, much like the rest of the film, makes very little sense, especially as the actor Timothy Farrell also acts as a narrator during the film.  I’m a little surprised the film hasn’t become more well known in our age of transgender activism but it might be because it’s too old and obscure.

A key aspect of all of Wood’s films is their incredibly low budget which contributes to their often poor quality. Wood had to rely on single takes and fast production in many cases to get his films made and Ed Wood portrays the various difficulties Ed faced while he was making his productions. For example, during the filming of Glen or Glenda, which was shot in just four days, Ed films a scene of Glen wearing a dress and looking at a female mannequin in a shop window and sighing. When a crew member spots some police officers, Ed tells his camera crew: “We don’t have a permit. Run!” Similarly, during the filming of Bride of the Monster (originally titled Bride of the Atom) Tor Johnson, playing the part of Bela Lugosi’s dim-witted assistant Lobo, smashes into the door frame of the set due to his large size but Wood does not bother to do another take. Wood says that “Lobo would have to deal with that problem every day.” Wood also relied heavily on stock footage in the place of actual sets and special effects as he knew a man who supplied it.

Wood’s lack of money also meant that he had to find funding for his pictures in unusual places. For instance, during the production of Bride of the Monster, Wood encounters actress Loretta King (1917-2007), who is played in the film by Martin Landau’s daughter Juliet, and mistakenly believes that King has enough money to fund the film.  After she expresses her desire to play the leading part, Wood is forced to give her the role which was meant for his girlfriend. During production, however, he discovers King only had $300 rather than the $60,000 he had assumed! To finish Bride of the Monster, Wood had to talk a rich rancher named Donald McCoy into investing $50,000 in the film. McCoy wanted his son to play the male lead and for the film to end with a big explosion which Wood accepted.

Later, to fund the production of Plan 9 from Outer Space (originally titled Grave Robbers from Outer Space) Wood convinced his landlords, who were members of a church, to fund the film by arguing that a hit science fiction film would help finance the church’s ambition to make individual films about the twelve apostles. Wood got the cast and crew to be baptised to get the church’s blessing to make the project. Because Tor Johnson was so big, however, they had to be baptised in a swimming pool! In the film, Bunny Breckinridge asks Ed after being baptised: “How do you do it? How do you get all of your friends to get baptised just so you can make a monster movie?” Plan 9 from Outer Space has since become infamous for its cheap special effects, poor acting and glaring mistakes such as gravestones tipping over and fake looking sets. One of my favourite lines in Ed Wood is when one of the Plan 9 producers protests: “Mr. Wood, do you know anything about the art of film production?” Plan 9 from Outer Space has been awarded the title of ‘worst film ever made’ although I would argue that there are far worst films.

Like all biopics, Ed Wood takes some liberties with actual events and several facts and figures are altered and simplified. For example, Bela Lugosi is depicted as swearing liberally in front of both men and women which would have been unlikely in the 1950s. Similarly, Lugosi is depicted as living alone and being solely dependent on Wood for company and support. However, the real Lugosi had a young wife in his final years and lived with his son Bela Lugosi Jnr. Nevertheless, you could argue that the film neither confirms nor denies the existence of his wife and son. Moreover, in real life Lugosi and Wood met through a mutual friend instead of the chance encounter depicted in the film of Lugosi trying out coffins because he was “planning on dying soon.” Furthermore, Lugosi is depicted filming his character’s death scene in Bride of the Monster which involved him lying down in ice cold water and flailing the tentacles of an immobile, fake octopus. In reality, this scene was filmed using a stunt double. The rumoured theft of the fake octopus is also depicted as having happened in the film. Lugosi being buried in his famous Dracula cape is in fact true although it was his family who made the decision and not Lugosi as described in the film. Overall, although Ed Wood does not always accurately portray Lugosi, it still presents him in a sympathetic light.

Depp’s performance as Ed Wood as a cheerful, optimistic and ambitious filmmaker also contrasts with the real Wood who was likely a sleazier character and who ended his days making obscure pornographic movies and dealing with depression and alcoholism. The film ends after the release of Plan 9 in 1957 without presenting Wood’s later years. Tim Burton has said that he wanted to pay tribute to Wood’s desire to be a filmmaker regardless of what he had to do and has said that the film is a depiction of Wood’s life and career how Wood would have liked to have seen it. Burton when describing the film said: “It’s not a completely hardcore realistic biopic…it’s got an overly optimistic quality to it.” Burton’s decision to portray Wood and those around him sympathetically was no doubt because Wood had been ridiculed from his death until the film was released.

Given these liberties with the truth, the film is not without its detractors which is inevitable when you are dealing with a film depicting real people. Bela Lugosi Jnr., for example, was critical of his father’s portrayal in Ed Wood and believed that the real Wood was exploiting his father’s past stardom and vulnerable position to help make his movies. Nevertheless, the film suggests that one of Wood’s motivations for starring Lugosi in his films was to help Lugosi out financially. Lugosi was also struggling with drug addiction at the time of his involvement with Wood and was one of the first celebrities to go to rehab publicly. In the film, Wood is shown to be the only person to visit and look out for Lugosi such as one scene when Lugosi is being hounded by paparazzi. In real life however, Frank Sinatra is said to have visited Lugosi as, like Wood, Sinatra was a fan. There is footage of the real Lugosi leaving the hospital on his recovery and shaking hands with the staff that helped him. Lugosi was also interviewed by the press and mentions that he is filming another film project with Wood called The Ghoul Goes West.

In Ed Wood, Wood is forced to discharge Lugosi due to lack of finances and Lugosi expresses to Wood his desire to make another film. Subsequently, Ed films a scene with Lugosi to placate him. In actuality, Wood and Lugosi were filming a scene for The Ghoul Goes West outside Tor Johnson’s house. Lugosi’s death in 1956 would end any possibility of that film getting made. The scene that Wood shot with Lugosi was instead used in Plan 9 for Outer Space and Lugosi’s character was played in additional scenes by Wood’s wife’s chiropractor covering half his face! This could be an example of Wood exploiting Lugosi for his own ends, but Wood apparently thought using the footage was a tribute to his friend. While it’s possible that the real Wood was taking advantage of Lugosi, many people believe that Wood was sincere in his care and concern for Lugosi and that the two were genuinely friends.

Another character in the film whose portrayal has caused controversy is that of Dolores Fuller who was Wood’s girlfriend in the early 1950s. In Ed Wood, Fuller is initially supportive of Wood and is herself an aspiring actress but is later horrified to learn about Wood’s transvestism during the filming of Glen or Glenda. Fuller and Wood’s relationship is shown to be further strained during the production of Bride of the Monster when Fuller’s leading role was given to Loretta King and she was left with only a minor part. After the release of Bride of the Monster, Fuller leaves Wood due to his continued lack of success and association with misfits. The Tim Burton biographer Ken Hanke has criticised the depiction of Fuller saying that Fuller in real life “is a lively, savvy, humorous woman.” Hanke goes on to say:

“Parker’s performance presents her as a kind of sitcom moron for the first part of the film and a rather judgemental and wholly unpleasant character in her later scenes.”

Ken Hanke

Fuller herself was critical of some aspects of the film but gave the film a positive review overall and praised Depp’s performance. In real life Fuller left Wood because of his alcoholism and difficult behaviour and said that she genuinely loved him. After leaving Wood, Fuller went on to have a successful career as a songwriter for artists such as Elvis Presley.

Towards the end of the film, Wood meets Kathy O’Hara (played by Patricia Arquette) at the rehabilitation centre where Lugosi is staying and she would become his wife and remain with him until his death. O’Hara never remarried and died in 2006. O’Hara is portrayed as accepting Wood’s transvestism and is always supportive of him. From what I read on Wikipedia (not always the most accurate source admittedly) Wood’s and O’Hara’s actual relationship was more tumultuous than what is depicted in the film as they both allegedly got violent with each other when drinking. The real Wood had also got married once before to a woman called Norma McCarty who appears as a stewardess in Plan 9 from Outer Space. This marriage was later annulled apparently after McCarty found out Wood was a transvestite. McCarty and the marriage are not depicted in the film.

One aspect of Ed Wood that is entirely fictional is Wood’s encounter with Orson Welles near the end of the film when Wood storms off the set of Plan 9 from Outer Space after frequent clashes with his producers. Wood goes to a bar and finds Orson Welles seated at a table and approaches him. Wood was a huge admirer of Welles and was inspired by his independent attitude to filmmaking. At the beginning of Ed Wood, Ed laments the fact that Orson Welles had made Citizen Kane aged 26 while Wood was still not a success aged 30. Welles is played in the film by Vincent D’Onofrio but his voice is performed by voice actor Maurice LaMarche. LaMarche famously voiced ‘Brain’ in Pinky and the Brain and has voiced characters in other animated shows like The Simpsons and Futurama.

During their brief conversation, Welles tells Wood about the trouble he had with the studio over making his most famous and acclaimed film Citizen Kane:

“You know the one film of mine where I had total control: Kane. The studio hated it. But they didn’t get to touch a frame. Ed, visions are worth fighting for. Why spend your life making someone else’s dreams?”

Orson Welles

This inspires Wood to return to the studio to complete Plan 9. The irony is that Welles tells Wood about his trouble making what is considered one of the greatest films ever made while Woods goes off to make what is considered one of the worst. When Plan 9 is screened at a theatre Woods looks at his creation with pride and says: “This is the one. This is the one I’ll be remembered for.” Again, the irony here is that the film will be remembered for its poor quality rather than the hard work and effort Wood put into it.

Fittingly perhaps, Ed Wood was not financially successful on its original release in 1994 despite being critically acclaimed but has gone on to gain a cult following like Ed Wood’s own films. Filming in black and white may have been one reason as this is a turn off for some people although it’s never been something that bothers me. Much of the praise was due to the film not mocking Wood but celebrating his ambition and determination. Films are notoriously difficult to make and even the worst films can be made with a lot of time and effort which is evident in Ed Wood. The late film critics Gene Siskel and Roger Ebert lauded the film on their popular film review show at the time of its release and Gene Sickel noted:

“Once when I started as a film critic somebody said to me ‘You know, there’s this old story about this producer who would applaud at the end of every movie because he knew how hard it was to get any movie made’ – that’s the spirit of this picture.”

Gene Siskel

Wood has gone on to be praised as a man who made an effort despite the limitations he had available to him. Jim Morton, who wrote a book called Incredibly Strange Films praised Wood saying:

“Eccentric and individualistic, Edward D. Wood Jr. was a man born to film. Lesser men, if forced to make movies under the conditions Wood faced, would have thrown their hands in defeat.”

Jim Morton

I haven’t expressed much of my own thoughts on the film in this post which I think is because I just believe it’s a very interesting story. Other films I write about (whenever that happens) may contain more analysis. One thing I’ll comment on though is the film’s 1950s setting. I think a lot of people have a somewhat cartoonish perception of the 1950s as a period of dull conformity and the 1960s as an explosion of colour, excitement and innovation. I wasn’t alive during those decades so I can’t comment on what they were really like to live through but that is how this period is often portrayed in popular culture. Ed Wood shows that the 1950s had its own complexities and fair share of odd and interesting characters, at least in Hollywood, and so this period shouldn’t be dismissed as been entirely boring or ‘square’. It’s also worth noting that issues like transvestism and transgenderism were being explored even in this period of more clearly defined roles between men and women – albeit largely at the fringes of society.

Another message I take from this film is that even if what you’re doing is hard work with very little payoff, if you stick with it you can still accomplish things – even if those things are not very good! I’ve found that even though I have put a lot of work into some of my posts and only received a limited response, I still feel proud at what I’ve managed to achieve, whether or not the posts themselves are any good.

I would definitely recommend Ed Wood to any film fans or anyone who likes Tim Burton and Johnny Depp’s other films. The biopic is ultimately a celebration of those who try even if they end up failing. Wood’s career has ultimately encouraged other struggling filmmakers to keeping going even if they don’t have the resources available to successful filmmakers and his films have come to have a cult following.

Useful links:

If you are interested in learning more about this film or Wood himself, I’d recommend checking out the links below.

  • This is a very well made review from 2012 by a YouTube channel called Happy Dragon Pictures which is where I got most of the information for this post.
  • Jonathan Ross presented this Channel 4 show in the late 1980s, before Ed Wood was made, which looks into Wood’s life and career. There are interviews with some of the people associated with Wood and it also gives some more background information such as what Wood did after he made Plan 9 from Outer Space.
  • This documentary was made after the film was released and explores in more detail the people who surrounded Ed Wood.
  • Wikipedia has articles about the film Ed Wood, the man himself and his films and you can even watch some of them for free on the site if you’re so inclined (or particularly bored!)

Thoughts on the Blank Slate

I recently read an article by Ed West on his Substack page in which he wonders why the blank slate theory of human nature still persists despite abundant scientific evidence against it and 20 years after Steven Pinker wrote The Blank Slate also refuting it.

In the simplest terms, the ‘blank slate’ theory posits that all or most human differences are the result of socialisation rather than biology or nature. Proponents of the blank slate theory can take issue with any suggestion that certain distinctions between individual human beings, such as sex differences or IQ, are products of nature rather than culture. In keeping with the rest of my blog, in this post I’ll focus here only on sex differences.

In his Substack article, Ed West writes:

“Rather than blank slate-led ideas falling into mockery and obscurity, the opposite has happened – they’ve proliferated and spread. Pinker was obviously right, yet seems to have lost.”

Ed West, The triumph of the blank slate

Evidence for this trend, according to West, comes from recent articles that deny certain differences between men and women such as one published in The Atlantic arguing whether or not boys have an advantage over girls in competitive sport and another from The New York Times suggesting that women’s maternal instinct is not natural (you can find the links on his post). More troubling perhaps is scientific publications such as Scientific American arguing that Western science only considered one sex – male – and the female body was considered inferior to it resulting in a ‘two sex model’ to reinforce gender divisions.

For me, the short answer to the question why blank slatism has persisted is because many influential publications, and institutions, have become dominated by people with the radical ideology we broadly call ‘woke’. I realise this is not exactly a groundbreaking revelation, but it is the simplest explanation to why the blank slate theory has still not disappeared.

Since ‘woke’ ideology assumes that Western societies have been formulated for the benefit of straight white males at the expense of everyone else, be they women, black or LGBT, any suggestion that, for example, male dominance in certain fields is a result of sex differences – rather than the preferred argument that men have gamed the system for their own advantage – is rejected.

I call this a ‘fact-narrative mismatch’ as any facts that go against the established ideological narrative are considered verboten. This has been complicated further by transgenderism, which argues that biological sex is determined more by personal identity than by our physiology. It was perhaps naive of us to assume that science would not be free of the kind of mental gymnastics that blank slatists engage in elsewhere even though science is meant to be objective and impartial.

Ed West notes at the end of his article:

“…as (Steven) Pinker points out, people can still fight for liberal causes while acknowledging these facts (MM: biological sex differences), but many people choose not to.”

Again, the reason for this is likely because it is easier to reject facts that go against a certain ideology than to try and incorporate the facts or change your beliefs to accommodate them.

The article concludes:

“It is odd that, as the evidence for genetic influences has stacked up, so the scientific community has come to be more enthralled to the blank slate. Strange ideas that Pinker confidently predicted were on the way out are stronger than ever, and the hereditarian view more, rather than less controversial — even such obvious facts as physical differences between the sexes are a matter of dispute.”

I would disagree slightly here because I think the controversy is more about the conflicting views of the pro-blank slate side vs the anti-blank side rather than one view taking precedence over the other. It is also likely that there are many people in the scientific community who have avoided getting involved in the discussion in the first place. Even feminists, who are often favourable towards blank slate theory, have ended up in conflict with each other over the transgender issue which challenges the existence of sex differences.

Ed West is correct however that blank slatism has been surprisingly robust even in scientific fields for reasons I have already mentioned. Furthermore, it is entirely possible that blank slate thinkers will eventually dominate the prominent scientific institutions – in which case we can only hope that genuine scientists can establish themselves elsewhere.

Nevertheless, is it possible to question or disagree with some of the conclusions reached by scientists about human sex differences whilst also being against blank slate theory? If you’ve read any of my previous posts, you may have seen my reviews of The Ape That Understood the Universe and Testosterone.

I am broadly in agreement with what the respective authors of those books, Steve Stewart-Williams and Carole Hooven, write about the biology behind sex differences and I thought both books were overall good. Even so, I pointed out in those reviews certain points that were made by Stewart-Williams and Hooven that I disagreed with. In short, I did not always share their opinion on certain sex differences even though I believe that sex differences do exist.

My main disagreement with Stewart-Williams and Hooven was not so much about the existence of sex differences, but more about how those differences are interpreted. I believe current understandings of sex differences can lead to a romanticised view of women over men which is one of the problems we have in current discourse. Steve Stewart-Williams was at least honest enough to note in The Ape That Understood the Universe that current theories about sex differences shaped by evolution present a more unflattering picture of men than they do of women.

Similarly, Carole Hooven ends up making vaguely feminist arguments in her book Testosterone despite presenting very good information about sex differences. You might say that beggars can’t be choosers in the present situation and we need to support academics who are against blank slate theory as much as possible. However, I think you can still support somebody even if you don’t always agree with them, which is often the case anyway. That doesn’t mean though that you can’t express scepticism towards some of their ideas.

For example, Steve Stewart-Williams and Carole Hooven both explore the more violent tendencies of men compared to women; I didn’t have too much of a problem with the information presented by either author; it is true for instance that men are more likely to commit crimes and acts of violence than women are. However, I got the impression sometimes from both books that male violence was some kind of taboo subject that believers of blank slate theory or other progressive notions were in denial about.

This assumption that male violence is a taboo subject reminded me of a post I once saw on Twitter which presented a graph on crimes rates between men and women. As you might expect, the line representing men was far higher than that of women, leading to mock surprise from commenters that men and women really are different after all. The responders possibly thought they were being very edgy and politically incorrect in expressing these sarcastic reactions but how many feminists would dispute this discrepancy? After all, look how much attention is placed on trying to change men’s behaviour and end so-called ‘toxic masculinity’.

To be clear, I’m not denying that men are more violent than women, only that pointing this out is not as provocative or dangerous to woke ideas as some people appear to think. In fact, this difference in violent behaviour between the sexes can lead to the following thinking process:

  1. Men and women are different
  2. Men are more violent than women
  3. Something must be done about male violence against women

Points one and two are correct, and point three is still reasonable, but this is hardly controversial for feminists. In addition, female violence is often overlooked or excused by the fact that women are on average weaker than men.

Let’s look at another claimed sex difference:

  1. Men and women are different
  2. Women are more empathetic than men
  3. If women had more power, then society would be better off because they would be more empathy and compassion.

I’ve written before about whether women are in fact more empathetic than men, so I won’t go over old ground. Maybe the difference in empathy is indeed true, but whatever the truth, point 3 is again something that feminists may believe themselves and they don’t have to have a blank slate view to come to that conclusion.

The fact that men are bigger, more physically stronger and more aggressive than women also fits very neatly with the feminist view that women are victims and men are perpetrators. Similarly, the fact that women are typically more risk averse and anxious then men can lead to the assumption women are naturally timid and need constant encouragement and support.

I guess the point I’m trying to make here is that acknowledging sex differences only takes us so far. It does not necessarily stop ‘woke’ or ‘progressive’ ideas such as feminism from taking hold. In fairness, this point was pointed out by Ed West and Steven Pinker in the above quote. Obviously, the answer is not to adopt the blank slate belief yourself, but I think having a degree of scepticism about some (but not all) of the current thinking about sex differences is important.

I admit there is a danger here in that you can end up in the same boat as blank slate thinkers in rejecting certain differences between groups because you personally dislike them. One way out of this is to consider how you deal with those you are in disagreement with. Do you believe that those with opposing views to yours should be prevented from expressing them or ‘cancelled?’. The answer for me would be no. It’s also crucial to have humility and not assume that your position cannot change in light of new information.

Returning to Ed West’s article, the impression I got from reading Steve Stewart-Williams’ and Carole Hooven’s books is reflected in what I read from West. In other words, I’m more or less on the same side as him, but I’m also more sceptical than he is about some of the current understandings on sex differences. I don’t mean obvious differences like men being physically stronger than women, but more complex ones such as differences in personality.

In his article, Ed West cites studies that suggest that personality differences are sex-linked and are larger in more equal societies than unequal ones. This increase rather than decrease in difference has been called the ‘gender equality paradox’ which suggests that efforts to eliminate barriers against both sexes allow sex differences to emerge freely. Occupational choices also seem to be more divergent between men and women in more equal countries which also supports this apparent paradox. There is likely some truth in this gender paradox, as well as the idea that both sexes have distinctive personality traits, but we can still run into the same problems I described before.

For example, Ed West states:

“When Jordan Peterson told Cathy Newman in a Channel 4 interview in 2018 that men tend to be more disagreeable than women, I was quite surprised by how many people were scandalised, seeing it as horrifically provocative rather than something so obviously true it takes courage to say it.”

Men are probably more disagreeable than women in the sense that men are more competitive and more likely to engage in physical violence, but I would still question the idea that men are more disagreeable than women as a general rule. It’s also important to note that personality tests are largely self-assessments, so subjectivity will affect results. Nevertheless, the pros and cons of personality tests are a topic for another day.

The assumption that men are on average more disagreeable is that, by contrast, women are more agreeable. Although we can easily find evidence that supports this idea – women are more nurturing, etc. it is easy to fall back into the same old narratives – women are victims, men are perpetrators and so on.

For instance, Jordan Peterson argues in his book 12 Rules for Life that agreeable people tend to sacrifice themselves for others and find it hard to stand up for themselves. This is often presented as one of the flaws of agreeableness. While being a pushover is certainly a flaw, it’s still a rather flattering one. People are far more likely to sympathise with an ‘agreeable’ person who is excessively selfless than a ‘disagreeable’ person who is excessively selfish.

If women are more agreeable than men, than perhaps something should be done about this. If only there was a political movement that wanted to ’empower’ women in some particular way? I’ve called this idea before the ‘women are too nice for their own good argument’ which seems to suggest that the worst thing about the female sex is their excessive compassion.

The mention of the gender equality paradox reminded me of a tweet I saw from Ed West a couple of years ago in which he posted a study suggesting that sex differences in narcissism were larger in egalitarian countries with men being higher (of course) than women. In response, I expressed scepticism in the comments like I have in this post.

If the reader thinks I’m just rejecting sex differences I don’t like, all I can say is we can still ask some questions: if women are becoming less narcissistic and more agreeable, why do men increasingly feel unhappy and discouraged about seeking relationships? Women who are high in agreeableness and low in narcissism would seem to be ideal marriage material, but many men are put off from getting married and are instead opting out. Women are also often presented as lacking self-esteem and being self-critical, yet women will freely criticise men while any criticism of women is met with outrage and women are told nothing is their fault.

I also don’t think the idea that women are more compassionate than men, like sex differences in violence, is particularly controversial. Notably, Steven Pinker argued in his book The Better Angels of Our Nature that the apparent decline in violence over the past few decades is partly the result of ‘feminisation’ and the ‘rights revolutions’ that have accompanied this. Women being less violent, according to Pinker, means they are more likely to advocate for non-violence. This is similar to the feminist idea that giving women more power will make the world a better place, and it came from the author of The Blank Slate himself! In this interpretation, femininity could be said to be the antidote to a world tainted by poisonous masculinity.

To be clear, I’m not suggesting there are no sex differences that give women an advantage over men. For example, I believe it’s probably true that girls pick up reading and writing quicker than boys do and can sit still for longer periods of time. This partly explains why girls tend to perform better than boys at school, although I don’t think it’s the only reason. Similarly, I think women can detect emotions in others more readily than men can, but I still wonder whether this is empathy as it’s traditionally described. I also think the idea that men and women are complementary – i.e. both sexes have strengths and weaknesses that balance each other out – is largely true.

Although I wouldn’t dismiss Steve Stewart-Williams, Carole Hooven or Ed West for simply having a different view of sex differences than mine – recognising that sex differences exist is as good a starting point as any of course – there is a danger that the conversation gets stuck in one interpretation and alternative ones are dismissed as the same as blank slatism.

As I’ve tried to show here, we can be against the blank slate and recognise that sex differences exist on the one hand but also debate some of the assumption about differences on the other. This is one of the reasons I decided to start this blog and something I’d like to write more about in future.

MMM#15: The Queen Is Dead

Queen Elizabeth II has been the Head of State my whole life so it’s strange to think that she is now no longer with us. I naively thought she’d make it to 100 as her mother died aged 101 and her husband died at 99. Since women typically live longer than men, I assumed the odds were in her favour even though I also knew that she was increasingly frail.

Her death comes at a time in the UK when we are facing a cost of living crisis and increasing cynicism towards our politicians and institutions. It’s hard not to think that the Queen’s death coincides with a particularly gloomy period of British history.

However, I did find the 10 day mourning period a welcome respite from the usual news even if some people may have found the media coverage about it to be excessive. It’s no surprise that there are a lot of people who are anti-monarchy and would rather the UK become a republic with an elected Head of State. It is also likely that anti-monarchists hated the displays of grief and pageantry that were ubiquitous earlier this month.

Although I’ve never been the biggest fan of the Royal Family – when Prince William and Kate Middleton got married, for example, I volunteered to work rather than have the day off to watch it – my opinion of them has changed over the years.

I’ve come to the position of preferring a constitutional monarchy over the alternative mainly because I hate the thought of a President Boris Johnson or Tony Blair! The fact that many of the anti-monarchy crowd tend to be devotees of wokeness is another reason to be on the opposite side. Having said that, I know people who have similar views to mine who are also against the monarchy.

Nevertheless, the argument that democratically elected Heads of State can be voted out unlike Kings and Queens doesn’t convince me since the kind of people who want to be elected to political office are often the ones who shouldn’t be there in the first place! Why assume that whoever replaces a bad Head of State will be any better? Monarchs can obviously be tyrants, but in most cases in the modern world they are driven to serve their subjects and try to put their personal views to one side. Whatever flaws the Queen may have had, I believe her devotion to serve the British public was a genuine one.

A blog I follow called ‘Grey Enlightenment’ also argues here that celebrities, politicians, athletes, etc. in the USA inspire devotion in people despite not being elected to any position of power by public vote. This post also notes that, especially in the case of athletes, their high status is partly down to some accident of birth like being naturally good at running and so is not that different to an individual who happens to be born into royalty.

Critics of the monarchy, and the Queen in particular, do not always come from the pro-republic and/or ‘woke left’ though. Some people on the political right have criticised the Queen for not intervening at certain times during her 70 year long reign to try to prevent changes which, to right-leaning critics, have made the UK worse. This is usually relating to controversial subjects like immigration or political correctness.

During the Queen’s time as monarch, the UK went from being a great world power with an empire to just a little group of islands off the coast of mainland Europe that may well splinter even further. The social changes that have happened during this period, whatever their pros and cons, have also contributed to the tension and divisiveness we see today. In this sense, it’s fair to say that the Queen took a decidedly hands-off approach.

However, I’m not sure what the Queen could have done to try to withstand these changes without threatening the institution of the monarchy. After all, during this same period, trust in other institutions like religion and the police also declined, ending what is sometimes called ‘the age of deference.’ The British Royal Family had also experienced threats to its stability earlier in the 20th Century with the abdication of Edward VIII and the overthrow of monarchies in other countries like Russia.

Like everyone else, the Royal Family have had to adjust to a rapidly changing technological world which has completely altered the way humans live their lives and contributed to atomisation. This, to me, is one of the reasons why there is so much tension today as we don’t have many things that we can unite around. The monarchy, or opposition to it, at least provides something to bring people together.

I watched some of the footage of what became known as ‘The Queue’ and saw people waiting for hours to walk past the Queen’s coffin to pay their respects and I was struck by how religious it felt. People from many different backgrounds were clearly inspired by the Queen and it shows that qualities like duty and sacrifice are still appreciated. Whether or not the new King can evoke a similar response remains to be seen.

MMM#14: Defending free speech

The attempted murder of Salman Rushdie earlier this month has given rise to people declaring the importance of free speech which is often threatened by fanatics and extremists, religious or otherwise. The only thing I knew about Salman Rushdie prior to this incident was that he wrote the novel The Satanic Verses which led to the infamous fatwa being placed on him by Iranian ruler Ayatollah Khomeini.

Nevertheless, despite not knowing that much about Rushdie, I admire his courage in remaining a public figure and advocating for free speech despite the obvious threats against him for his work. The fatwa against Rushdie has not only resulted in this recent attempt on his life, but also the murder, or attempted murder, of translators of The Satanic Verses like Hitoshi Igarashi and William Nygaard. If I was in a similar position, I don’t know if I would be so willing to expose myself to such threats even though I know this would compromise free speech.

The importance of freedom of speech is highlighted by the willingness of people to defend other’s right to speech even if they disagree with them. Theodore Dalrymple notes in this article that Rushdie has said things that Dalrymple finds objectionable but still recognises that Rushdie is a “staunch and brave supporter” of free speech.

Although most people recognise that freedom of speech is important, such a stance is not without its difficulties, particularly in the culture war era. Rational centrist types might advocate for a world that is based primarily on logic and freedom of expression but it is likely that societies will never be totally free of taboos no matter how liberal the most powerful countries in the world become.

It’s telling after all that the socially liberal/neoconservative worldview of “making the world safe for democracy” has been met with a pushback by countries who have been occupied by the US and its allies such as Iraq and Afghanistan. The Western values that were offered to these places obviously conflicted with the taboos and customs that are prevalent in the Middle East. Not everybody wants a McDonalds in every street corner and a rainbow flag flying in every embassy. Personally, I’d prefer to live in the West but I recognise that people grow up in different environments and circumstances so will not have the same attitudes as me.

The ongoing conflict between Russia and Ukraine is also in some ways a clash against two different worldviews which could be simplified as nationalism on one side and globalism on the other with the unfortunate Ukrainian citizens caught in the middle of it all. While I don’t want to come across as too sympathetic to the Russian side, it’s notable that any criticism of the Ukrainian government (as opposed to Ukrainian citizens who I have every sympathy with) or the portrayal of the conflict by Western media as biased against Russia will result in attacks and condemnation. Here we see that freedom of speech in the West has its own taboos and heresies.

We can also see this in other areas. Would public broadcasters like the BBC, for example, employ a presenter on their TV or radio channels that openly opposed gay marriage, was critical of feminism or expressed scepticism towards other sacred cows like climate change? The answer is very likely no. This is in spite of the fact that many people who work for the BBC would likely be supportive of Salman Rushdie.

It has been pointed out by other political commentators that despite many institutions like the BBC being obsessed with all kinds of diversity, they do not try to promote diversity of opinion. One reason for this may be because the positions that I deemed as impossible for a BBC presenter to openly express (anti-gay marriage, feminism, etc.), would be considered ‘oppressive’ and therefore anti-free speech. That such positions would likely be held by religious extremists is also seen as evidence of their oppressiveness.

Social media sites have the same mindset as broadcasters in blocking or preventing the expression of ideas they find oppressive. An argument used by advocates of ‘woke’ or ‘political correctness’ in support of bans on platforms like Twitter is that these companies are private and so should have the freedom to ban whoever they like. Paradoxically, then, free speech can be used to prevent free speech.

This complex and contradictory aspect of freedom of speech has led me to think that it is not possible to have open debate without some amount of taboo and intolerance, although what this would look like is itself open to debate. Being free to speak and express ideas always appears to lead to some boundaries being set up even if these boundaries have some flexibilities. Even though I believe in as much freedom of speech as possible, the inevitability that certain ideas and thoughts will be discouraged and restricted seems to me to be a realistic observation.

In a sense, the culture wars are not just a battle for freedom of speech, but also over what issues societies should be prejudiced and censorious about. In other words, should we attack or restrict ideas that are thought of as dangerous towards designated victim groups, or against ideas that are dangerous towards Western civilisation?

Considering the intense and difficult debates that Western societies will have to address in years to come, such as how people with completely different worldviews and cultures can peacefully co-exist with each other, the relationship between men and women, and race relations among others, it’s at least a good thing that there are people like Salman Rushdie who will fiercely defend free speech, even at their own risk.

MMM#13: Are Women Being Erased?

Since Holy Pride Month has come and gone, I thought I’d write about an issue that currently dominates LGBT discussions.

Controversy around transgenderism continues to appear frequently in the news: the comedian Ricky Gervais’ latest stand up special included a segment in which he mocked issues such as transgender access to women’s toilets, the Labour MP Stella Creasy gave a bizarre interview for The Telegraph newspaper in which she argued that women can have a penis, the conservative commentator Matt Walsh has released a documentary entitled What Is a Woman? and Jordan Peterson had his Twitter account suspended for a comment he made about the trans actor/actress Ellen/Elliot Page.

The ongoing conflict regarding transgenderism has led some to conclude that women, in particular, are under threat since we seem to be unable to define what a woman is. For example, Brendan O’Neill wrote an article in The Spectator back in 2017 arguing that the word ‘woman’ was being erased from public life.

Similarly, the American conservative organisation The Heritage Foundation wrote about the erasure of women escalating in this piece. However, it has been noted that, since the overturning of Roe vs. Wade by the US Supreme Court, progressives have suddenly remembered what a woman is!

Are we heading towards a dystopia in which nobody can tell the difference between men and women and in which women themselves will be erased as a recognised group altogether? My own feeling is that this is highly unlikely.

While I like Brendan O’Neill’s content for the most part, it should be noted that five years have passed since he wrote his Spectator article and the word “woman” still remains in use in public, although the reader might argue that it too soon to argue against this claim.

A similar accusation is often made towards feminism wanting to erase all differences between men and women. There is truth in this, but I believe it is often overstated. Feminists can put forward the blank slate theory of human nature one moment and then suddenly notice differences between men and women when it suits them to do so. Obviously, this doesn’t mean there isn’t a problem as there is clearly confusion about how to define the two sexes.

Although I sympathise with many women’s concerns over issues like transgender athletes and the access that men who identify as women may have to female toilets and changing rooms, it should be noted that worries surrounding women and their safety have not exactly disappeared following the rise of the trans movement – #MeToo and the Sarah Everard case being just two examples in recent years.

It is interesting, after all, that even lesbian feminists like Julie Bindel (one of the more independently minded ones, admittedly) are on the same side as Harry Potter author JK Rowling in opposing the excessive claims of the trans rights movement. Again, while I agree with many of the arguments that so-called “trans-exclusionary radical feminists” (TERFs) like Ms Bindel and Rowling have made, my sympathy towards them is limited. This is because TERFs have been happy to push forward progressive ideas when these ideas benefitted women at the expense of men and have only objected to such ideas when they appeared to disadvantage ordinary women.

I have my own conspiracy theory that the trans movement was pushed forward by some feminists as a way to rejuvenate their own movement as many women no longer identified with feminism or, more accurately, considered themselves to be ‘post-feminists’ who had believed that feminism had run its course. The apparent threat of transgenderism in erasing women has helped feminism have a new cause to fight against even if it involves a lot of infighting – although infighting is common in feminism anyway. I’m not saying my conspiracy theory is true necessarily, but it’s fun to think about.

Most of the anger coming from feminists on this issue is likely because they believe their slice of the victim pie has just got a little smaller. I can imagine many of the feminists campaigning against the trans lobby suddenly aligning with them and saying both have a common enemy in straight men and the patriarchy when it suits them.

I’ve seen a few people wondering why transgender issues appear to affect women more than men and why women seem to be in more danger of being ‘erased’. It is often concluded that misogyny is the answer. However, there are other reasons that can explain why transgenderism has affected women rather than men, such as:

  • Since men are, on average, physically stronger than women a man who identifies as a woman is perceived as more of a danger in an all-female space.
  • Women arguably have a stronger sense of identity than men so any issue that encroaches on female spaces will be considered a bigger deal. Even an issue that could affect male identity, e.g. a transman who is pregnant, will be seen as more of an issue that affects women for obvious reasons.
  • In some ways, femininity is more flexible about boundaries than masculinity as it is easier for women to cross boundaries defined by sex than it is for men. For instance, women have entered previously male-dominated spaces more frequently than men have entered formerly female-dominated spaces (notwithstanding the current transgender controversy). Similarly, women are more likely to be bisexual than men who typically identify more as either heterosexual or homosexual. Therefore, the current transgender issues are possibly a reflection of this flexibility in femininity working against women.
  • Male identity has already been made vulnerable by feminism – e.g. women moving into spaces which were once exclusively occupied by men – and this remains so regardless of transgenderism, which will also have some effect.

Our obsession with transgenderism is disproportional to the actual number of people who identify as trans or ‘non-binary’ in the same way that people often overestimate the number of people who are gay. This article suggests that 1% of people in the UK recognise themselves as transgender which amounts to slightly over 600,000 people although that estimate may be inaccurate since no everybody will be identified. Notice that ‘identify as’ is not the same as ‘are’.

In other words, although 600,000+ people is a lot, this is miniscule compared to the 60 million+ population of the UK. Even though these numbers appear to have increased, they are still comparably small. Similar findings are likely in other countries of comparable or larger populations. It’s possible that the pro-trans rights lobby would use this argument to deflect any criticism against them by accusing opponents of overreacting so my point here is in no way to dismiss the concerns women have about all of this.

Even in this age of supposed “gender fluidity”, most of the teenagers and young people I encounter are still recognisably male or female even though there is probably more who identity as “LGBT” or what the comedian Dave Chappelle calls “the alphabet people.” On the other hand, I am aware that there has been a concerted effort to push trans ideology on children at a younger and younger age.

But if the number of transgender people is so small, why are public figures such as Labour leader Keir Starmer unable to answer questions like “what is a woman?” The mealy-mouthed response from such politicians is indicative of their well known tactic of not answering a question directly. On the surface, it is obviously absurd that there are people who can’t answer a question like what a woman is but I believe the issue is not so much that they don’t know, but rather that they don’t know HOW to answer that question. It is similar to a child asking their parent “where babies come from”: the parent knows the answer, but not necessarily how to explain it.

Politicians, mainly on the Left, are caught in what the South Park character PC Principal would call a “PC pretzel” where they cannot give a definite answer without upsetting a certain group of people. There is also an element of ‘having your cake and eating it’ about all of this as I’ve noticed articles about pregnant women using “women” and “pregnant people” almost interchangeably as a way of covering all bases to avoid any controversy.

For all of the concern about not being able to identify women and women being erased, it should be noted that the obsession with women’s issues in the media has never gone away. For example, a recent drama appeared on TV called Maryland which was yet another lamentation about male violence against women.

At the heart of this controversy appears to be whether we can define ‘man’ or ‘woman’ in purely biological terms or on individual terms.

I could be too charitable here, but I imagine their encapsulation of “what is a woman” would look like this:

  • majority – adult who is biologically female (cis)
  • minority – adult who is intersex/not biologically female but identifies as such

A man who feels like a woman trapped in a man’s body may believe he is truly a woman even though biologically he’s not. While this could be seen as taking philosopher Rene Descartes famous statement “I think, therefore I am” way too far, in our age of all-inclusivity, even these minority cases are included in the group ‘woman.’ In this sense, Stella Creasy saying that a woman can have a penis – if a man genuinely believes he is really a woman born in the wrong body – has some logic if you define ‘man’ and ‘woman’ as terms that can be applied depending on how you perceive yourself,. but you have to do a lot of convoluted thinking to get to that point. Even if you don’t agree with the explanation I’ve offered here, it makes more sense than the incoherence spouted by the people interviewed in Matt Walsh’s documentary, which is reviewed here.

At best, we can say that human are made of two sexes, male and female, plus a grey area where trans and intersex people (such as those described in Carole Hooven’s Testosterone) occupy and whose numbers, as already pointed out, are few and far between.

In these circumstances, we have to weight the concerns of the majority group – so-called ‘cis-gender’ women – with the minority of those men, who for medical and/or psychological reasons, identify as women.

I think eventually Labour and other Left-leaning parties will have to take a clear position on this as they will lose support and votes if they continue to be ambiguous.

I’m willing to hold my hands up and admit I’m wrong if the dystopian, genderless society does come to pass, but for now I believe that reports of women’s erasure have been greatly exaggerated.

MMM#12: Johnny Depp and Amber Heard

Although it’s a little belated I thought I’d write briefly here about the Johnny Depp and Amber Heard trial which ended a few weeks ago and featured prominently in the news.

I looked at the news of the case only occasionally while it was ongoing rather than following it live as some people have done but I was interested by the amount of sympathy that was directed by many towards Johnny Depp, a man, over Amber Heard, a woman, which was in contrast to many cases of relationship conflict which tend to portray women in a more positive light.

Despite this being the age of culture wars and stark divides between people on a variety of issues, I was struck by how many people, regardless of their sex or political leanings, seemed to support Johnny Depp over Amber Heard. Who would have thought it would take a case like this for a consensus to be reached?

Of course, there were a few people who sided with Amber Heard and many more who were indifferent to the case and wondered what all the fuss was about.

I’ll admit that I was more on Johnny Depp’s side partly due to believing he had been a victim of the #MeToo hysteria but also because I have watched and enjoyed some of Johnny Depp’s films whereas the only Amber Heard films I knew were The Rum Diary (where she met Depp during the filming) and Aquaman and I’ve seen neither of them. Bias is always a danger in a case such as this as you can inadvertently mould facts to favour or disfavour whichever person you happen to be for or against.

Nevertheless, I understood people who took a more neutral position and thought both Depp and Heard were as bad as each other. Johnny Depp, given his excessive drug taking, is far from perfect and appears to be a poor judge of character. Who’s to say he won’t fall into another dysfunctional relationship?

It was encouraging to see women speaking out against Heard and the assumption that they should believe her because she was female although this may have been motivated by their fondness for Johnny Depp. Whilst looking at responses to the trial online I stumbled upon a woman who goes by the name ‘Colonel Kurtz’ (I’m aware that’s the character Marlon Brando played in Apocalypse Now), who has made videos defending Johnny Depp and, more controversially, the musician Marylin Manson who has been accused of sexual abuse by his ex-girlfriend Evan Rachel Wood.

I was particularly interested by this 1 hour 45 minute video that Colonel Kurtz made over a year ago in which she analyses a number of Amber Heard interviews to explore Heard’s possible psychological problems. This video also features the very creepy looking Elizabeth Holmes who was behind the Theranos scandal. Later I retweeted Colonel Kurtz’s tweet noting that people’s interest in Amber Heard was partly because Heard represented the reality of false accusations by women (in Kurtz’s opinion at least) against men which had been denied by the media.

The idea that psychologically damaged women could use #MeToo to peddle false or exaggerated accusations of abuse by men was not something many journalists were comfortable with. It was amusing to see the mainstream media contort themselves into trying to make Amber Heard the innocent victim being bullied and harassed by online trolls which was illuminating in how reporting is driven by narratives instead of facts. At the time of writing, Amber Heard has continued to portray herself as the victim in public appearances following the verdict being ruled in Johnny Depp’s favour.

That being said, there was an element of a media circus being created to air the couple’s dirty laundry for the audience’s amusement and for us to observe how messed up Hollywood celebrities really are. On the other hand, the broadcasting of the trial did show the benefit of being able to observe a legal dispute between a man and a woman which allowed the public to see how both parties presented themselves rather than having to rely on potentially biased accounts by the media. I believe that most of the support that Depp received was down to him coming across as more genuine than Heard as well as having a far more competent legal team.

The Depp/Heard trial can be compared to other ‘he said, she said’ trials for more serious offences like rape. In discussions over how to handle rape prosecutions, there is often a debate about whether accusers should be allowed to be anonymous while the accused is named or whether both or neither side should be given anonymity.

I used to think that both the accuser and accused should be given anonymity but I’ve started to think it would be better if neither party was anonymous since it allows a neutral observer to decide for themselves who they think is telling the truth. Inevitably, there will be people who instinctively side with one person over the other but it seems better than allowing such controversial cases to occur behind closed doors. I doubt the suggestion that anonymity should not be allowed in rape cases will gain much traction though since the old excuse of “this will prevent victims from coming forward” will be argued by the growing number of people who seem to think “accuser” always means “victim”.

If the Marylin Manson case features prominently in the news, it will be interesting to see if there is a similar reaction to what has occurred with Depp vs. Heard. However, since Manson is not as well known or as well liked as Johnny Depp, I don’t believe the same amount of support will be present.

If there is one positive outcome to the Depp/Heard trial, I think it is that a lot more people, whether they are men or women, have become more sceptical about #believeallwomen and #MeToo.

Book Review: ‘Testosterone: The Story of the Hormone that Dominates and Divides Us’ by Carole Hooven (Part 3)

Chapter 8: T and Sexuality

There’s a story about the US President Calvin Coolidge and his wife touring a poultry farm and being shown around separately. The story might be fictional, but it forms the basis for a joke. The gist of it is that the farmer tells Mrs. Coolidge that the rooster can mate frequently and vigorously to which she replies, “Tell that to Mr. Coolidge.” When Calvin Coolidge is told about the rooster, he asks if it mates with the same hen or with different ones. The farmer tells the President that the rooster mates with many different hens, to which Calvin Coolidge responds, “Tell THAT to Mrs. Coolidge.” This story, whether true or not, inspired the naming of a phenomenon called the ‘Coolidge effect’.

The Coolidge effect is when a male whose sexual interest has declined after mating will experience a renewal in interest when it encounters a new female. This has been observed in many different animals. I was aware of the effect before reading this book but I’m surprised that it was not explored in either of Steve Stewart-Williams’ and David Buss’ books. Carole Hooven suggests that the Coolidge effect may have been an adaptation in males to take advantage of a mating opportunity which could be costly if not pursued. The neurotransmitter dopamine, which is involved in motivation, and T are both involved in creating and recreating this sexual interest.

The description of this effect introduces the theme of this chapter: how T influences sexuality and sex drive. A well known difference between men and women, for instance, is that men typically have a higher sex drive and a greater desire for more sexual partners than women. Evidence for this includes men’s greater consumption of prostitutes and pornography. Studies have also shown evidence of the Coolidge effect in men watching pornography as sexual arousal increases when a new woman is introduced. T is partly responsible for this difference between the sexes.

Sexual and romantic interest emerges at puberty with the release of sex hormones in boys and girls. Boys, of course, will experience a sharp increase in T levels unlike girls. As already established in previous chapters, the T rise in boys influences the parts of their brain that have already been exposed to T in the womb and immediately after birth. Girls experience a release of oestrogen and progesterone instead of T but, in either case, the majority of boys and girls will become attracted to the opposite sex following puberty.

Carole Hooven points out that culture has an effect on sexual behaviour as well. Sexual practices and attitudes can differ all around the world depending on a particular society’s customs. For example, oral sex by boys on men in the Sambia of Papua New Guinea and polygamy among Mormons in the United States is/was acceptable despite both activities been condemned in many other cultures. Attitudes towards homosexuality also vary from being accepted (some might say to an excessive degree) in Western countries and rejected (again, perhaps to excess) in regions such as Africa and the Middle East. Regardless of these factors, the difference in men and women’s sex drive is a consistent finding cross-culturally which indicates that biology is involved.

The reason for the difference in sex drive and sexual variety between males and females has already been partly explained in Chapter 6 with the stags on Rum: males who compete and obtain the most females can increase their reproductive success. By contrast, females have no greater reproductive success competing for a harem of males.

However, Chapter 6 also shows that males of different species will vary in their behaviours. Rum stags are not involved in caring for their offspring whereas male birds will pair bond with females to care for their young. This is because deer calves can survive without any paternal investment whilst birds are helpless as chicks. Similarly, human babies are completely helpless when they are born unlike deer who can walk a few hours after birth. Like birds, humans pair bond to care for offspring.

Carole Hooven writes:

“Not surprisingly, women tend to prefer mates who don’t just have high social status but who also signal willingness to invest in them and their children. Men who fail to signal these qualities and who are just out for a good time may have a harder time finding healthy, fertile mates because women are exercising their reproductive choices.”

There is logic to this but pick-up artists (PUAs) may well disagree with what Carole Hooven claims here. Whether or not you approve of what PUAs do, these men have been successful in attracting women without necessarily signalling to such women they are going to invest in her or her children. Furthermore, how many young women are simply “out for a good time” like men? Moreover, there are men who have fathered children with different women despite not sticking around afterwards.

The author notes that men benefit from staying to raise offspring since, like birds, paternal investment increases the likelihood of babies surviving. T levels will vary depend on if men are trying to attract women or in a committed relationship as previously explained in the book. Men in a relationship or caring for offspring will have lower T:

“Lower T in this situation is associated with being a more devoted partner.”

Again, there is logic to this but women may be less attracted to men who have decreased T. Also, low T has disadvantages in men such as low energy and possibly depression which is not good for relationships.

Similar to the “challenge hypothesis” explained in the sixth chapter, men who have children can experience a rise in T in certain situations such as hearing their baby crying which is possibly to trigger a protective response.

In my opinion, the T levels of men who are single or in a relationship are at what the author has previously called the “Goldilocks level” or “just right” rather than being simply high or low. Carole Hooven noted in the beginning of the book that we typically associate T with men even though women also have T so talking about “high T levels” and “low T levels” can come across as saying “more male” or “more female”. In other words, if men have low T in relationships, this could be seen as being “more female” and therefore better than “more male” high T.

This chapter also analyses the role T may play in influencing sexual orientation. The book claims that the only exclusive homosexual behaviour observed outside of humans is in male domesticated sheep although does not state whether this is in the presence or absence of females. However, Chapter 4 showed that hormonal exposure can affect sexual behaviour such as female rats exposed to T in the womb and in adulthood engaging in mounting which is a predominately male trait.

Although human homosexuality is more complicated, Carole Hooven points out that the stereotype of “lesbian mechanics and gay flight attendants” – i.e. homosexual men and women exhibiting behaviour typical of the opposite sex – has some truth to it. Lesbians and gay men are more likely to identify themselves as less feminine or masculine respectively and are more likely to be in professions that are atypical of their sex.

In childhood, girls who identify as lesbian when they grow up are more likely to show typical boy behaviour such as rough and tumble play and playing sport while boys who identify as gay later on can behave in more female-typical ways.

If T plays a part in developing sexual preferences, it appears to have more of an effect on females than males as there is more evidence of increased T creating lesbian-typical traits than low T creating traits typical of gay men. For example, girls with CAH (mentioned in Chapter 4) are exposed to high levels of T in the womb and are more likely to behave like boys and be attracted to women when they grow up. Nevertheless, Carole Hooven concludes that is unclear if T influences sexual orientation as it is difficult to measure the amount of T that babies may be exposed to in the womb and we do not know exactly when fetal brains differentiate to become male or female.

Although some gay men may identify as less masculine than heterosexual men, gay men are more likely than lesbians to engage in casual sex with many partners, tieing in with the earlier point of men preferring sexual variety more than women.

The author writes:

“In comparison with their straight cousins, on average, gay men do have many more sexual partners. Lesbians do not, and are much more likely to be sexual within committed monogamous relationships.”

Like Steve Stewart-Williams, who makes a similar point in his own book, Carole Hooven does not mention that married lesbian couples are more likely to divorce than other couples so shouldn’t necessarily be seen as the gold standard for committed relationships. The point about sexual variety still stands though:

“Gay men have more sex simply because they can, it’s not a “gay” thing, it’s a “man” thing.”

Here are some other interesting points from Chapter 8:

  • It is unclear if T increases sex drive in women like in men since T is harder to measure in women. T and oestrogen also both peak around ovulation and vary during the menstrual cycle. Other factors such as age and cultural norms can also play a role. Women with conditions like CAIS (which means they are unresponsive to androgens like T) can show typical sexual responses.
  • “Digit ratio” of fingers may indicate the level of early T exposure in the womb. Men and women differ on average in the length of their index finger (the second digit or ‘2D’) relative to their ring finger (fourth digit or ‘4D’) which gives the digit ratio (2D:4D). Men and women’s index and ring fingers are either roughly the same length (which is the case for me, not that anyone cares) or one finger is slightly longer than the other one. In women, the index finger is more likely to be longer than the ring finger and vice versa for men. This means that women’s digit ratio will be higher than men’s. This relationship has been observed in utero and in other vertebrates. This is only a “noisy” signal of T – i.e. has some correlation but is weak – but could be useful to measure group differences. The image below might make this clearer.

Chapter 9: T and Transgenderism

In the book’s penultimate chapter, Carole Hooven explores men and women who have gender dysphoria or are “transgender” and how T may be involved in this. She interviewed several people who either “transitioned” female-to-male (FtM) or male-to-female (MtF) in addition to people who transitioned back.

The author notes:

“Trans people who drastically alter their T levels are in a unique position to offer insights into how life is different when they cross over the other side of the testosterone line.”

The number of people who identify as transgender has risen greatly over the past few years, partly in my view because of its ubiquity in political discourse. According to the book, in one review, the number of people in the US who identified as “trans” in 2017 was double what it was a decade earlier. Additionally, in the UK, referrals to the NHS Gender Identity Development have risen 50-fold.

The author mentions a couple of famous transgender cases such as Jazz Jennings, a MtF celebrity who was apparently diagnosed with gender dysphoria at age 3 and Buck Angel, a FtM celebrity who looks like, in Dr. Hooven’s words, a “heavily tattooed version of the action hero Vin Diesel.”

Given the dramatic effects “transitioning” from one sex to resemble the other can have, there are unique complications for both FtM and MtF cases.

As described in Chapter 5, the effects of T on the body of men, or DSD individuals like Caster Semenya, are difficult to suppress even with hormone therapy. The physical changes undergone during male puberty cannot be undone by increasing hormones like oestrogen.

Carole Hooven compares the difficulties of MtF transitioning to renovating a property. The parts of a property that require maintenance such as the decorating or gardening can be easily modified but the more stable parts such as the brick walls cannot be easily changed.

In the case of a male body transitioning to resemble a female body, the “brick wall” components such as bones, facial structure and vocal cords will remain the same in the absence of T and are difficult to change. Conversely, the “maintenance” components of the body like muscles, fat and reproductive system are less difficult to modify as they rely more on T.

As the author explains:

“Testosterone’s bricklike effects are the reason that physically transitioning in the male-to-female (MtF) direction is so much harder than the reverse (FtM).”

Dr. Hooven interviewed a MtF individual named “Kallisti” who began transitioning to a woman in his(her?) early 30s and the author points out the obvious difficulties:

“I had to make an effort to override the masculine signal her voice sent over the phone, and it was easy to see why this could make life difficult for Kallisti.”

Hormones act on the larynx or “voice box” which affects, amongst other things, the pitch and quality of voice. During male puberty, T binds to androgen receptors in the tissues of the voice box to strengthen and elongate them which increases the depth of voice. Only surgery on the vocal cords can alter this as hormones will have no effect. It is easier for a FtM individual to change their voice to be more masculine but this still might not be as deep as a normal male due to the different size and shape of a woman’s voice box.

“Laryngeal prominence” otherwise known as ‘Adam’s apples’ are more prominent in men than in women to the point where it is sometimes believed that women do not have one. Adam’s apples protect the vocal folds and are joined together by cartilage tissue at a sharper angle in men which is what causes the greater protrusion. During FtM transition, increasing T will lead to a slight growth in Adam’s apples.

High T also means more “terminal” body hair which is coarser and darker than soft, pale “vellus” hair. DHT, mentioned in previous chapters, is responsible for stimulating this hair growth. For FtM transitioning, hormone exposure will result in an increase in hair on the body and face. For MtF cases, it is more difficult to reverse the effects of androgens on creating body hair since terminal hair cannot be reversed back into vellus hair. Often procedures such as laser treatment are needed.

The changes that occur in male and female bodies during puberty makes it difficult for those with gender dysphoria to have the body that they believe correlates with the sex they identify with. “Puberty blockers” are used to prevent the natural development of boys and girls into men and women as a way for people who struggle with their sex identity to “buy time” and decided whether they want to transition or not.

As you can imagine, puberty blocker use has increased and is very controversial. Puberty blockers were originally created to treat children who suffered from “precocious puberty”, in other words, puberty that starts in children much earlier than it is supposed to. This fact reminded me of plastic surgery, which was originally intended to treat people who had been mutilated and disfigured but was then used for more controversial purposes such as cosmetics.

Carole Hooven interviewed a child called “Sasha” who is a boy who took puberty blockers and is a potential MtF case. Although Sasha preferred girls clothes and items over boy’s, he was reluctant to use feminine pronouns and identifies as “non-binary”.

From what Sasha tells Dr. Hooven during their interview, I get the impression that there may have been some outside pressure involved as well, as Sasha has been to “transgender sleep-away camp” for a few years and then went to a “gender clinic” after friends from the camp went to one. Here’s what Sasha said when asked about being offered puberty blockers:

“I was more leaning towards it, but not that much. So when they asked me, do you want a puberty blocker? I said, oh, maybe, maybe not. Not really sure…I had…five other meetings and…I was, like, “probably”, “most likely”, “yeah”, “I really want to…”

Sasha

Sasha does not want to go through male puberty but also does not want to completely identify as female. After taking a puberty blocker, Sasha claims that he may start taking oestrogen even though he is unsure he wants to. He would not mind having female traits, but does not want to have “male everything”.

Carole Hooven takes an impartial position, which is fair enough, but I think that Sasha may need counselling of some kind to ascertain why he feels the way he does rather than simply being placed on puberty blockers.

Puberty blockers tend to work “upstream” by blocking signals from the brain telling the body to produce sex hormones rather than directly blocking sex hormone receptors “downstream”. The most widely used puberty blocker actually activates the gonadotropin-releasing hormone (GnRH) receptor which is vital to trigger puberty.

This seems paradoxical, but the blocker triggers a constant response from the GnRH receptor rather than the normal response of gradual “hits” which are necessary to trigger a response from the pituitary. Constant activation rather than intervals of activation result in the pituitary no longer responding to signals from GnRH. Therefore, there is no sex hormone release.

The author explains that there is very little research on the long-term effects of blocking puberty in children with gender dysphoria as the practice is relatively new. There are some predictable outcomes however: children who have been given puberty blockers tend to be shorter and lack the physical development of other children going through puberty. Additionally, since puberty increases bone strength, blocking puberty could lead to permanently weak bones.

Although puberty will resume when children on puberty blockers stop using them, such children/adolescents will be “out of sync” with their peers which can cause emotional and psychological difficulties. Similarly, starting puberty later may not result in the same outcomes as normal puberty. Carole Hooven also notes that blocking puberty may reduce opportunities for gender-dysphoric children to explore their feelings about identity which is common for all adolescents.

According to the book, 95% of children who take puberty blockers will decide they want to transition and take cross-sex hormones. As already described, the effects of cross-sex hormones are less reversible than puberty blockers.

Dr. Hooven writes:

“When someone decides to hormonally transition, no matter their age, they are signing up for a lifetime of medical dependence on hormones.”

Fertility will also be affected depending on when gender-dysphoric children stop taking puberty blockers or start taking cross-sex hormones. Puberty may proceed long enough for sperm or eggs to be produced which could be harvested before transitioning.

Given the complexity and controversy around all of this, the author wisely argues:

“Particularly where blockers are concerned, parents and caregivers should consult with qualified professionals, preferably getting a second or third opinion…to provide the best support possible to young people who are making these life-changing decisions, much more research is required.”

This chapter concludes by exploring people who transitioned from one sex to the other before deciding to “detransition” and re-identify with their biological sex. Having been exposed to cross-sex hormones, both FtM and MfF individuals have experience about what it is like to occupy a male and female-typical body. Here are some of the changes that occur which reflect sex differences:

  • FtM and MtFs experience a change in libido. For example, “Alan”, who was FtM, noticed an increase in libido whereas Kallisti (mentioned before), a MtF, experienced a decreased libido but orgasms became a “whole body experience”. “Stella”, a FtM who detransitioned back into identifying as female, noticed an increase in libido which then decreased after stopping cross-sex hormones.
  • FtM cases like Alan and Stella noticed they cried less when taking cross-sex hormones like T. Their “emotional threshold” was higher. The author notes that women cry more and are more likely to have depression. I would point out here though that men’s suicide rate is three times higher than women’s.
  • Kallisti (MfF) became less physically angry after transitioning. However, Carole Hooven argues that changes in anger with or without T are no consistent:

“there’s no reason to think that T will turn a placid female-to-male transitioner into a hot-tempered Incredible Hulk.”

Although T obviously has an effect on the brains and body of those who transition female-to-male, as well as its absence in male-to-female individuals, it is not known if variations in T levels in the womb have any effect on whether a boy or girl will have gender dysphoria.

Nonetheless, there is some evidence that girls who had high prenatal T levels are more likely to have gender dysphoria, similar to the greater likelihood of high-prenatal T girls beings lesbians when they grow up.

Chapter 10: T and Conclusion

The final chapter of the book is also the weakest as it is essentially a summary of the content covered previously. Carole Hooven also weighs in on more social and political issues relating to T which, as I’ve already mentioned, is where the book is less convincing.

Dr. Hooven describes how both men and women are often frustrated by each other’s behaviour but, since men are the primary focus of the book, the attention here is on women’s feelings about men, or, as they may exclaim, “Men!”:

“My personal impression is that these somewhat playful “Men” sighs are a reaction to an objectifying sexuality, difficulties listening and expressing emotions, or ego insecurities that seem to motivate an unearned sense of confidence about, well, almost everything.”

The author does admit that this remark “has the ring of sexism” which is why women often only utter it around other women. The last point about men having “an unearned sense of confidence” is indicative of the idea that men and boys need to be ‘taken down a peg or two’ whereas women and girls alternatively need constant encouragement and support. Later, Carole Hooven also mentions men feeling “the need to confidently explain the obvious” which presumably refers to the idea of ‘mansplaining’.

I don’t want to come across as being too upset or ‘triggered’ by these remarks since there’s probably an element of tongue-in-cheek from the author here but a lot of this chapter does come across as Carole Hooven conveying the mentality of “how to solve a problem like men?”

Moreover, she suggests that understanding biology could be useful in helping to deal with societal problems like sexual assault, reflecting David Buss’ point in his book Bad Men:

“Solving problems requires understanding their causes. If we consistently downplay one set of potential causes (say, biological) in favor of another (say, social), then we have failed to do our best to get to the truth. And that means that we have also ignored opportunities to increase women’s safety and equality between the sexes.”

This does sound like using biology and science to push feminist ideas, again similar to Bad Men, but Carole Hooven is right to recognise the importance of biology. She returns to the scepticism of the media towards the effects of T described in Chapter 1:

“The popular press is full of attempts to bring King T down, to show that he is too big for his boots, or more generally to dismiss biological accounts of psychological and behavioral differences the sexes.”

The author describes what she believes are the reasons for this resistance in accepting T’s effects:

“It appears to have its source in three main worries. First, people think that the T view suggests that testosterone is destiny. Second, they think it suggests that male behavior is natural, and thus good or acceptable. And third, they think it suggests men aren’t to blame – their T gets them off the hook.”

Off the hook for what? – you might ask. Sexual assault is one example possibly. The case of Chanel Miller, who was involved in a sexual assault case against Brock Turner, is described here. This case was also mentioned in Bad Men. Miller and Turner were students at Stanford University and Turner was found lying on Chanel Miller on campus around 01:00am by two Swedish students. Turner subsequently tried to run away but was apprehended by the students. Turner was sentenced to 6 months in jail which was considered a miscarriage of justice.

In 2019 Ms Miller, who was known during the case as “Emily Doe”, revealed her identity by publishing the memoir Know My Name. Carole Hooven is sympathetic towards Chanel Miller but the incident between Ms. Miller and Brock Turner appear to be more complicated. I recommend the reader look at these blog posts exploring the case, which was critical of the simplistic narrative put forward by the media. Bob Somerby, who wrote the posts, notes:

“At trial, Turner testified that he and Miller left the frat party together, and that Miller consented to engage in sexual behavior once they got outside. Did Miller voice some such consent? We have no way of knowing, but then again, neither does Miller! By her own account, she doesn’t remember anything she said and did after roughly midnight that night, and the assault occurred a roughly 1 AM.”

The Daily Howler – The Age of the Novel

This post also makes a compelling point:

“In these cases, we’ve moved beyond the already difficult “he said/she said” dynamic to a different state of affairs, in which “he says/she can’t remember.”

The Daily Howler

In short, Miller’s version of events is open to scrutiny given that she was too drunk to remember what was happening which is likely why Brock Turner initially got a light sentence.

Similarly, Dr. Hooven is sympathetic towards the #MeToo movement:

“Testosterone tends to promote high libido and the acquisition of mates, and if a man’s power, a culture’s failures, or a victim’s powerlessness can do the trick, that will be the road taken by some. But we can also put roadblocks in the way. #MeToo is a movement that has made real progress, and hopefully that will continue.”

I’m less enthusiastic about the movement since it is basically the usual ‘female victims, male perpetrators’ narrative but I won’t hold that against the author since support for #MeToo is the mainstream opinion. Also, Carole Hooven does point out in the notes at the end of the book that there may have been some overreach with #MeToo.

The chapter continues with describing the reluctance that some have in accepting the effects of T due to its contribution to “undesirable male behavior” and possibly leading to the conclusion that “there’s nothing that can be done to curb men’s excesses.”

The author argues that being upset about facts does not change them, reflecting that she was upset upon learning her father had cancer but she could not change the fact that he did. This is a good point, but the argument still comes across as ‘men are a problem, and here’s the science to prove it.’

Here’s some similar quotes from the book:

“Some may worry that if people believe that T is responsible for reprehensible male behavior, then it provides men with a free get-out-of-jail card.”

Sort of like women and feminism perhaps? Dr. Hooven also asks:

“What’s the appropriate response to the fact that men do the majority of raping and assaulting, not to mention hoarding the world’s power?”

The idea of men “hoarding the world’s power” is similarly indicative of feminist thinking. Nevertheless, Dr. Hooven balances all of this slightly by acknowledging that men are more likely than women to perform heroic acts as well.

Some of Carole Hooven’s viewpoints were likely influenced by what she reveals in this final chapter: she was once a victim of rape.

She does not elaborate on the details of the incident (not that she has to) but explains that some of her distress at hearing Randy Thornhill’s theory of rape as an adaptation was influenced by her own experience years before. This also influenced her desire to study testosterone:

“It’s only through writing about men and testosterone that I have come to appreciate that my driving desire to learn about testosterone and how it works might have something to do with my own difficult experiences with men. But it hasn’t been all bad: while some men have wounded me, far more have supported, mentored, and encouraged me.”

Overall, I think Carole Hooven is a ‘good egg’ and has intelligence which she’s put to good use. I can also understand why she would be influenced by feminist ideas even though I don’t agree with them.

Summary: I definitely learnt a lot about testosterone from reading this book so I can recommend it for that reason. Carole Hooven does a good job of presenting a lot of scientific information in a clear and interesting way with the help of Felix Byrne’s hand-drawn illustrations. Reading this book alongside The Ape That Understood the Universe should give you a good understanding of sex differences and biology, whether or not you completely agree with the authors.

Thank you for taking the time to read this review.

Book Review: ‘Testosterone: The Story of the Hormone that Dominates and Divides Us’ by Carole Hooven (Part 2)

Chapter 5: T and Performance in Sport

The fifth chapter of this book explores the role of T in physical activity and how this leads to differences in male and female performances. The issue of men who have transitioned and compete in women’s sports is a notable and ongoing controversy since men have a natural physical advantage over women.

This issue is not restricted to trans-women though. The South African athlete Caster Semenya had to undergo testing to determine her sex after other runners complained about her dominance in athletics, which included winning the 800m Gold at the 2009 World Championship as well as in the 2012 and 2016 Olympics. Pierre Weiss, the General Secretary of the International Association of Athletics Federations (IAAF) – now known as ‘World Athletics’ – clumsily remarked Semenya “is a woman, but maybe not 100 per cent.” Possibly to counter claims she was a man, Caster Semenya appeared in the South African magazine You wearing make-up and a dress to appear more feminine. This can be seen below.

Semenya has high levels of T because she has a difference of sex development (DSD) condition. This elevated T is why she had been so successful in athletics as this gives her an advantage over other female athletes.

In 2018, the IAAF introduced new regulations to deal with DSD-affected athletes like Caster Semenya. In order to compete in women’s sports, such athletes have to take drugs to lower their T levels or otherwise be banned from competing. Semenya has refused to lower her T levels, believing that the regulations were brought in to target her, and so is not allowed to compete in certain events.

As evident in previous chapters, some people refuse to believe that T creates such distinctions between men and women, or women and intersex people. A transgender activist called Veronica Ivy (who changed her name from Rachel McKinnon for some reason), has argued that the relationship between T and sports performance is flawed. Ivy was born a man but transitioned to a woman and went on to compete in cycling and become a World Champion. Do you think she may have some ulterior motive here?

Other sports stars are more honest. The former tennis champion John McEnroe commented that while Serena Williams is the best female tennis player in the world, “if she played in the men’s circuit she’d be like 700 in the world.” Despite the subsequent controversy over McEnroe’s comments, Serena Williams admitted that she would lose to male tennis players.

To show why T gives men an advantage over women in sports, Carole Hooven presents the fictional boy-girl twins Samuel and Sofia as an example. Sam and Sofia compete against each other in sports but after puberty Sam always has the advantage over his sister.

This is the same for men and women in general. According to Carole Hooven, in 2019, 2500 men beat the fastest women’s time in the 100m event and women’s world records are around 10% lower than men’s. This is why men and women rarely compete together:

“Without segregation, it’s not just that men would win – women would never even qualify for the competitions in the first place.”

Veronica Ivy, however, has argued that the performance gap between men and women is closing. Carole Hooven states that this is incorrect. There are others like Veronica Ivy who are just as stubborn against the facts. A psychologist called Beth Jones appeared on the BBC Radio 4 show Woman’s Hour (a very feminist-friendly programme) to discuss transgender athletes and argued that women could improve by competing against men!

Similarly, Rebecca Jordan-Young and Katrina Karkazis, mentioned in Chapter 1, have argued that T is not an indicator of performance as athletes with the highest T levels do not always win competitions. The author counters by pointing out that this is within athletes of the same sex rather than between men and women so this is a “bait and switch” tactic by Jordan-Young and Karkazis.

Nevertheless, it is true that T levels vary between individuals and even then are not static. We have higher T in the morning than at night and T levels decline as we age. Physical activity will also reduce T levels for a period. Levels of T are often measured from extracts of blood or saliva but this is not without complications. Most of our T is bound to carrier proteins and only 2% is unbound or “free” so the levels of T measured may include both kinds. Additionally, measuring levels in women is more difficult than in men because other androgens in women may increase T level detection.

Again, there is scepticism about T in this domain. Sari van Anders, from Queen’s University, Canada, claimed that men and women’s T levels overlap and the binary is purely political. It won’t come as a shock to learn that Sari van Anders is involved in transgender activism. Ms. van Anders’ argument is contradicted by studies of T levels detected using mass spectrometry (MS), what Dr. Hooven calls the “gold standard” of T measurement. The endocrinologist David Handelsman did a meta-analysis of studies of T measured using MS and found that there was no overlap in T levels between men and women. This is shown in the book by the graph drawing below:

This is in contrast with height differences between the sexes where there is overlap. These studies only measured healthy men and women however. Would the distribution of T levels be different if, say, DSD conditions were included? A study by Richard Clark measured T levels including those with DSD conditions like CAH and 5-ARD which have been described previously. Conditions like CAH and polycystic ovarian syndrome (PCOS) lead to increased androgen production so will have some effect on T levels. However, even this does not cause overlap between men and women as seen below:

The author returns to her hypothetical twins Sam and Sofia to discuss how they would have developed in the womb and then in adolescence. Chapter 4 explained how males are exposed to T in the womb years before boys experience an increase in T during puberty. There is also an increase in T shortly after male babies are born which has been called a “mini-puberty” although the reason behind this is not well understood. Puberty is of course where boys and girls start to diverge more clearly. This is initiated by the hypothalamus in the brain.

The hypothalamus releases gonadotropin-releasing hormone (GnRH) which triggers the pituitary, also in the brain, to release lutenising hormone (LH) and follicle-stimulating hormone (FSH) into the bloodstream. LH and FSH would stimulate the release of hormones from Sam’s testes and Sofia’s ovaries respectively. The T released in Sam’s body leads to changes such as increased muscle growth, increased bone growth and heightened haemoglobin levels. In contrast, Sofia would experience more fat generation than muscle. This inevitably has an effect on how well the twins would perform at sports. After puberty, Sam would be able to outcompete Sofia easily.

Carole Hooven also explains that women with PCOS, which increases T, were found in one study to be over-represented in elite sport. 37% of Swedish female Olympians had PCOS which is three times the population rate. The mainstream media also regularly reports DSD women athletes as having “naturally high T levels” without mentioning their DSD condition, which may mean the athletes have XY chromosomes and male genitals! Complicating matters is the fact that the benefits of T, like muscle and bone size, would remain even if athletes like Caster Semenya were to take drugs to lower their levels. The author writes that she is unsure how to resolve the problem of DSD and transgender athletes since neither side of the argument will be completely satisfied. But, Caster Semenya and others like her should be treated with respect.

Chapter 6: T and Mating

Years after her trip to Uganda to observe chimpanzees, Carole Hooven visited the Scottish island of Rum to observe its abundant red deer population.

During mating season, called the “rut”, male stags will compete against each other to mate with females, called hinds, which the stags guard in harems. A few stags will have harems of hinds whilst other stags will have none.

One stag, named by the researchers there as “Wisdom 11” – the name of its mother, Wisdom, and the year it was born, 2011 – was particularly successful in mating. This was because Wisdom 11 was big, strong and healthy which meant he could challenge other stags and dominate territory.

However, other stags without harems may attempt to mate with hinds behind a successful stag’s back, earning the less successful stags the name “sneaky fuckers.”

Another stag, named Tattler 06 (mother Tattler, born in 2006), challenged Wisdom 11 by approaching and responding to Wisdom 11’s roars by roaring back. Other stags may have backed off when met with roars. At this point, the two males did not engage in fighting:

“Like most people, red deer stags don’t make a habit of recklessly jumping into a physical conflict. Fighting is risky and draining and is best reserved for when the rewards – usually hinds or increased dominance that might help to get hinds later – are worth the risk.”

In short, stags prefer to intimidate rivals by roaring instead of engaging in combat with them which could be harmful. Roaring is also an indication of dominant stags’ size, strength and therefore fighting ability. A rival who roars back to challenge a dominant male may eventually back off, but Tattler 06 remained. This ramped up the challenge. Both Tattler 06 and Wisdom 11 moved towards each other and battled with their antlers. If one stag can force the other to the ground, the stronger stag will force its antler tip into the weaker stag’s flank to injure it. Afterwards, the fight starts again. The author writes:

“It all struck me as rather gentlemanly. No cheating, no funny stuff. They were following all the rituals on the road to battle I’d read and taught about for many years.”

Wisdom 11 ultimately won the challenge as Tattler 06 eventually backed off. Carole Hooven witnessed similar skirmishes during her short stay on the island. Wisdom 11 even challenged another harem holder called Glariola 09 and ended up winning and taking Glariola 09’s four hinds!

Similar to the chimpanzee Imoso in Chapter 1, stags may attack hinds who stray or are unresponsive to mating. Hinds are less aggressive than stags because, as Carole Hooven puts it, they are not competing for a “reproductive jackpot.” Compared to dominant males, females will not produce as many calves so there is minimal competition between hinds.

Outside of mating season, male red deer do not compete for females and the sexes live separately. Stags’ testes “shut down” leading to a drop in T levels and their antlers fall off. The author calls this a “temporary castration.” Antlers start to grow again after the old ones have fallen off but are covered in a velvet-like coating to supply blood to the new ones. When mating season comes round again in the autumn, T levels increase resulting in changes in the body once again. As with other animals, T exposure in the womb works on stags to allow for changes later in puberty. Similarly, during mating season, increase in T allows for changes to occur in stag bodies without any complications.

Increase in T affects stags in the following ways:

  • The “antler velvet” that supplies blood for regrowth is shed to reveal the new antlers.
  • Increased calcification of bone which makes stags stronger, particularly the antlers.
  • Increased muscles around the neck which are used for fighting.
  • Increased shaggy mane around the neck to make the stags more intimidating.
  • Increased red blood cell production which increases oxygen transport and stamina.

Like what has been described in earlier chapters, Carole Hooven presents experiments that have been carried out on the Rum stags to discover the effects of T. In one experiment in the 1970s, stags were castrated at different times of the year – in and out of mating season – to see what effect this would have. Castrated stags lost their antlers and the regrown antlers remained covered in velvet and weak. Essentially, the body changes listed above that follow T increase were absent – no extra neck muscle, no shaggy mane, etc.

The absent T was then replaced in the stags using slow release capsules during mating season and outside of it to see if this had any effect. The stags returned to normal mating behaviour when hinds were fertile but did not show “rutting behaviour” outside of it. The author suggests other “cues” need to be present for the stags to engage in a rut such as seasonal changes. However, outside of mating season, stags with elevated T will still fight with other stags to display dominance.

A key motivator for stags fighting for dominance, like with other males, is to gain access to females. Females prefer to mate with dominant males over weaker ones. This is the underlying theory of ‘sexual selection’ which can be divided into male-male competition and female mate choice.

The author writes:

“The quintessence of this kind of sexual selection by “mate choice” is the peacock, with his train of long, brilliantly colored and decorated feathers. The peahen’s backside, by contrast, looks stunted and dull.”

Charles Darwin theorised that the ornamentation of male birds like the peacock is a result of female mate choice in his book The Descent of Man, and Selection in Relation to Sex.

“When females actively choose certain males for mates, whether it be the beautiful, bold, melodious, mean, or fragrant, her “decisions” are likely to be forceful drivers of the evolution of his secondary sex characteristics”

If you’ve read my review of The Ape That Understood the Universe, you might have seen my mention of an alternative theory that raises questions about this theory of sexual selection in peacocks. Although it’s nearly a year since I wrote that review, I’m still planning on writing about this alternative theory and hopefully posting it very soon.

Aggression and dominance are not restricted to males, however. Females of other species who fight each other for dominance include naked mole rats, spotted hyenas and meerkats. For the most part though, females tend to be less aggressive than males as there is usually less benefit for them.

This chapter also describes other animals that have similar breeding seasons to the stags on Rum. Arizona spiny lizards also have a breeding season in the autumn but male T regulation is not as up and down as that of stags. Just after mating season has ended during winter and spring, the lizards have low T levels but this increases during summer before the new mating season.

Male lizards will begin showing displays of dominance towards other males such as bobbing their heads in the summer before females come along in the autumn. Carole Hooven writes that T is at the “Goldilocks level” – in other words, is “just right” before autumn when T levels will increase. Why do these lizards have an intermediary period of T levels between mating seasons? Wouldn’t having high T levels be advantageous, even in the summer?

Again, experiments have been carried on these lizards to observe the effects of T on behaviour. Predictably, castrated lizards show no interest in females and are not aggressive or territorial. In contrast, lizards given T during the summer increase their territorial and dominance displays. While this would suggest the high T lizards would have the upper hand going into mating season at the end of summer, apparently 50% of the high-T lizards had died by this point compared to 20% of the ordinary lizards. The high-T lizards “came out of the gate too fast” – i.e. used up a lot of their energy guarding and patrolling their territories which made them vulnerable. Conversely, normal lizards saved their energy for the autumn and spent time resting and eating instead.

Male birds go through similar cycles of T but their mating behaviour is slightly different. John Wingfield, an evolutionary biologist who has studied birds (Carole Hooven notes his name is appropriate) found that song sparrows in the US have fluctuating T levels depending on if they are competing for females or providing for females and their chicks.

Like many species of bird, song sparrows will pair up for a season to look after their offspring and the males’ T levels will drop during this period. Males who were given an increase in T spent more time guarding territory and competing for new females instead of looking after chicks. Like with the spiny lizards, having “Goldilocks level” T is important for mating.

Elevated T does have its uses in this scenario however. Caged male birds placed in a wild bird’s territory will cause the wild male to confront and attack the caged bird who it perceives as a threat. As expected, the wild male bird’s T levels go up when responding to an intruding male. This has been called the “challenge hypothesis.” This response enables the males to protect their territory and their ‘family’:

“In short, T levels fluctuate depending on whether a male needs to be ready to breed, care for his family, or fight off rivals.”

Chapter 7: T and Violence

Chapters 2 to 6 are very solid in terms of scientific information and insight highlighting Carole Hooven’s qualities as an academic. The final four chapters (8 to 10 will be covered in Part 3) explore in more detail the role of T in explaining human behaviour.

It is at this point that the book dips a little bit in quality in my opinion as we get into more social commentary. That doesn’t mean these remaining chapters are not worth reading though.

The aggressive, dominant and territorial behaviour that is evident in male animals when T is increased has obvious parallels with human behaviour and particularly male violence. The chapter starts by describing an incident that happened to the writer Daemon Fairless, author of the book Mad Blood Stirring: The Inner Lives of Violent Men. During one New Year’s Eve in the subway of Fairless’ home city Toronto, a drunken young man was attempting to open the train doors which resulted in Fairless confronting him. The confrontation escalated into the two men getting into a fight. Carole Hooven notes that this incident would rarely play out between two women.

This inevitably leads to exploring “toxic masculinity.” The anthropology professor Matthew Gutmann has studied masculinity for many years and wrote the book Are Men Animals? How Modern Masculinity Sells Men Short where he argues that male violence and aggression can be largely explained by socialisation rather than biology. According to Carole Hooven, Professor Gutmann believes there is “little relationship with T and aggression.” In this way, his argument is similar to modern perceptions of sex differences being a product of nurture rather than nature. Moreover, the American Psychological Association has put forward the idea that male aggression is a production of “gender role socialisation” which is aimed at upholding “patriarchal codes” by requiring men to act dominantly.

Carole Hooven, of course, believes that these assumptions are incorrect and, in fact, T and biology do play a role in male violence. As shown in Chapter 6, one reason for aggression in males is to compete for females. Nevertheless, Dr. Hooven concedes that not only men can commit acts of violence:

“it would be a mistake to think of women as incapable of promoting – and sometimes of carrying out – extreme acts of violence. In 1994, during… genocide in…Rwanda…Pauline Nyiramasuhuko was the minister for Family Welfare and the Advancement of Women. She was later convicted of charges of genocidal rape. One witness recounted that right after Nyiramasuhuko ordered militia members to burn seventy women and girls using gasoline she had in her car, she said, “Why don’t you rape them before you kill them?””

Intimate partner violence (IPV) statistics also present conflicting and controversial facts about the prevalence of violence between men and women. Helen Gavin and Theresa Porter report in their book Female Aggression that wives are more often perpetrators of physical assault in relationships than men according to a study from Detroit. Similar results have been found in cities like London, Budapest and Stuttgart.

Here Carole Hooven reveals a weak spot in her thinking, in my view at least, and we get to one of the low points of this book. While I would broadly agree with Helen Gavin and Theresa Porter’s findings, Carole Hooven instead responds:

“When I first learned of this evidence, I was skeptical. It ran contrary to everything that I thought I’d learned about domestic abuse, and it was hard to imagine women as significant perpetrators.”

Dr. Hooven goes on to say that because women are generally physically weaker than men, they are less likely to inflict damage than men are on women. This is important to consider when discussing IPV, but the point is whether its prevalence is heavily skewed in one sex or the other, notwithstanding if men can inflict more damage than women.

The author also describes how empathy may play a role. Below is my least favourite passage from this book, and probably where I would disagree with Carole Hooven the most:

“Empathy is our ability to understand how others are feeling, and men are less able to do this than women, across cultures. This is a widely replicated and consistent finding, and it’s not true just of human males and females. In chimpanzees, bonobos, gorillas, elephants, dogs, and wolves, researchers have observed that males engage in lower rates of behavior related to empathy, like caregiving, cooperating, helping, and comforting.”

Carole Hooven might as well be saying here that “women are just better people!” although I don’t think she actually believes that. The point that females tends to do more caregiving and comforting is true, but this to me is like saying that extroverts are more empathic than introverts since extraverts prefer to be socialise and be around people whilst introverts may prefer to spent time by themselves. As far as I can tell, reports of empathy seem to rely on self-assessments and so could be considered subjective.

A few months ago, I retweeted this comment on one of Jordan Peterson’s tweets. The commenter noted that the word ’empathy’ didn’t exist until the early 20th Century and thus psychological study was biased towards a concept that humans beforehand had not even given a word to. It would take me too long to explore this further here, but I think ’empathy’ is often used to put forward the ‘women good, men bad’ viewpoint. Even when empathy is considered to be a flaw, the reasoning follows what I would call the ‘women are too nice for their own good argument.’

Dr. Hooven even suggests that violent men’s “reduced empathy” makes male-perpetrated IPV worse than female IPV. By this logic presumably, when a woman attacks her husband or boyfriend, it’s from a place of empathy and compassion, unlike that of nasty men.

Carole Hooven also mentions Margo Wilson and Martin Daly’s theory that most female violence is self-defence which I discuss a little bit in my review of Bad Men. Let’s just say I’m wary of that idea as well. I may have my own bias in rejecting these arguments, but they still strike me as simply “mental gymnastics” to explain away any understanding of IPV that doesn’t fit the ‘female victims, male perpetrators’ narrative.

Overall I found this part of the book disappointing. I realise that Carole Hooven is a public figure and I’m not, and that she’s a biologist rather than a psychologist, so we can be somewhat lenient towards her stance here since she’s likely relying on conventional wisdom. I don’t expect her to align 100 percent with my own views either. Furthermore, none of this takes away from what she has written before or her merits as a teacher.

With that out of the way, I’ll return to the book.

The author does point out women and girls are not necessarily less aggressive than men, but are instead more likely to engage in indirect aggression. Aggression itself can be divided into two categories: “reactive aggression” and “proactive aggression.”

Reactive aggression is instantaneous and often a response to triggers that make someone angry or threatened. It is more common between two individuals. Proactive aggression is more calculated such as planning an attack. It is more common in groups or institutions such as the military. The book claims that neither sex has a monopoly on either kind. The relationship with T and reactive aggression is clearer than T and proactive aggression and is the main focus of this chapter.

Measuring aggression can be difficult but one option is to study violent crime statistics since these are more likely to be recorded. As mentioned in Chapter 1, men are more likely to commit violent crime than women. Most murders, for example, are male-on-male. Other evidence includes studying male skeletons unearthed by archeologists which are more likely to show death by violent conflict. The author writes:

“The more risky, extreme, and cruel the violence, the larger the sex difference, and the greater the proportion of male offenders.”

Physical aggression by men is more beneficial than it is for women, as shown in Chapter 6. Adaptations for aggression in males is evident in the fact that men are generally bigger and stronger than women, take more physical risks and engage in more rough and tumble play in childhood.

Aggression and violence are correlated with T so rising and falling levels will have an effect. There are two situations where T levels in males are particularly sensitive: those relating to sex and those relating to violence or threat.

Humans and one of our closest relatives, chimpanzees, are not seasonal breeders like the animals described in the previous chapter. This means that the testes, in Carole Hooven’s words, “are always on the go.” The T levels of males in many species are usually highest when females are fertile. In female chimps, fertility is ‘advertised’ by “sexual swelling” of their backsides. For humans, however, this is different as women’s ovulation is concealed. The author suggests this is one reason men stick around even when women are not pregnant although also notes that children are more likely to survive if fathers are around as well. T levels in men will alternate depending on if they are trying to attract a woman (high) or if they are in a relationship and have children (low or at least lower).

Violence is usually a last resort tactic in animals because of the costs that go along with it, reflecting the confrontation between the two stags described in Chapter 6. The threat of violence allows stable hierarchies to form within groups, such as in primates, with the dominant primates being able to assume power over weaker ones. Similarly, men in smaller societies such as hunter-gatherer types would know their place within a hierarchy based on similar kinds of dominance. The more successful men will rise though the hierarchy based on their abilities as a hunter. The book notes that T levels are not only determined by biology, but are also situational. For example, in response to danger, a man might become bold and face it or afraid and flee – i.e. the ‘fight or flight’ response. The divergent reactions are related to T as an increase will usually result in the more bolder response. Alternatively, fleeing may result in a drop in T.

Biological differences may explain how T changes result in differing responses between individual men. The androgen receptor, which T binds to, is more effective in some men than others. This likely explains why some men, for instance, can grow beards easier than others and are stronger and more aggressive. Studies have found that the DNA sequence in the androgen receptor gene has a repeat of C-A-G bases or “CAG repeats.”

If you are not familiar with DNA bases, there are four types, called adenine, cytosine, guanine and thymine or A, C, G, T (not to be confused with testosterone). Adenine joins to thymine and cytosine to guanine to form the DNA double helix. A DNA sequence consists of the four bases so a “CAG repeat” may look like this:

CAGCAGCAGCAGCAGCAGCAG…

These bases would join together with a sequence that looked like this:

GTCGTCGTCGTCGTCGTCGTC…

Hopefully that will make the following clearer.

Having fewer CAG repeats in the androgen receptor gene means that the receptor will be more effective and therefore show a greater response to T. This has downsides however as fewer CAG repeats is linked to a higher probability of getting prostate cancer and “spontaneous abortions” in pregnant women. Men with short CAG repeats are said to get more pleasure out of being aggressive. T release is also linked to the release of dopamine which influences motivation and reward.

According to Dr. Hooven, T reduces empathy since motivation and reward are increased and fear and the perception of pain are decreased. Despite my reservations about the author’s earlier claims about empathy, I have to concede here that there may be something to this. It makes sense that violence and risk-taking require detachment to some degree in order to focus on the violence/risk being undertaken. On the other hand, we could debate whether ‘detachment’ and ‘decreased empathy’ are the same thing. I still think empathy is a vague term that should be debated.

Nevertheless, T does not always stimulate excessive violence. The endocrinologist Robert Sapolsky has studied aggression in animals such as talapoin monkeys in his book The Trouble with Testosterone. A study in which talapoins were given an increase in T led to more aggressive behaviour but this was directed towards other talapoins below them in the monkeys’ dominance hierarchy rather than a violent free-for-all. Thus, T could be said to work as a ‘performance enhancer’. Carole Hooven explains:

“T is not a potion that turns the meek into warriors or that causes rampant bellicosity. Its effects depend heavily on individual and environmental factors, and in humans especially, winning and achieving high status can often be accomplished without any physical aggression at all. T tends to do what the situation requires.”

The male body must therefore be able to undergo “rapid T changes” in order to react to an unpredictable situation. According to Carole Hooven, it is not known at present how the body can respond so quickly to these rapid changes since it takes time for T to bind to a receptor then move into a cell nucleus to stimulate gene transcription. One possible explanation is that T acts like a neurotransmitter and interacts with the cell surface as well.

The author concludes this chapter by pointing out that culture has an effect on the prevalence of violence. In Singapore, for example, there are very strict laws which has resulted in a low crime and murder rate. Carole Hooven writes:

“Frank talk about T will help us appreciate how changes in the environment can rein in problematic male behavior.”

Is it only men who are the problem though? It’s one thing to accept that men commit most crimes and violence, but we shouldn’t assume that women are either innocent victims or simply bystanders because of this. Since male violence may result in an increase in status, power and resources, why should we think that women would have nothing to do with it? The idea that anything that is male-dominated will only benefit men is what I call the “by men, for men fallacy” which I might write about at some point.

Here are some other interesting facts from this chapter:

  • Personality likely affects how men may react to a threat to their status and reputation. “Dominance-oriented” men who are also impulsive are more likely to respond to increased T with aggression.
  • Rapid T level changes have been observed in sport as levels will fluctuate in response to a win or loss. During the 1994 FIFA World Cup final (Italy vs. Brazil), which was held in the US, researchers from Georgia State University collected saliva from Italian and Brazilian football fans before and after the match to measure T. Following the match, the T levels from the Brazil fans stayed the same or increased whereas the levels in the Italy fans declined. This was because Italy lost and Brazil won.
  • Similar effects to winning and losing have been tested in women. However, there is scant evidence that T mediates female competitiveness. It is possible though that other hormones may be involved instead.

This review will be concluded in Part 3.