Book Review: ‘Testosterone: The Story of the Hormone that Dominates and Divides Us’ by Carole Hooven (Part 2)

Chapter 5: T and Performance in Sport

The fifth chapter of this book explores the role of T in physical activity and how this leads to differences in male and female performances. The issue of men who have transitioned and compete in women’s sports is a notable and ongoing controversy since men have a natural physical advantage over women.

This issue is not restricted to trans-women though. The South African athlete Caster Semenya had to undergo testing to determine her sex after other runners complained about her dominance in athletics, which included winning the 800m Gold at the 2009 World Championship as well as in the 2012 and 2016 Olympics. Pierre Weiss, the General Secretary of the International Association of Athletics Federations (IAAF) – now known as ‘World Athletics’ – clumsily remarked Semenya “is a woman, but maybe not 100 per cent.” Possibly to counter claims she was a man, Caster Semenya appeared in the South African magazine You wearing make-up and a dress to appear more feminine. This can be seen below.

Semenya has high levels of T because she has a difference of sex development (DSD) condition. This elevated T is why she had been so successful in athletics as this gives her an advantage over other female athletes.

In 2018, the IAAF introduced new regulations to deal with DSD-affected athletes like Caster Semenya. In order to compete in women’s sports, such athletes have to take drugs to lower their T levels or otherwise be banned from competing. Semenya has refused to lower her T levels, believing that the regulations were brought in to target her, and so is not allowed to compete in certain events.

As evident in previous chapters, some people refuse to believe that T creates such distinctions between men and women, or women and intersex people. A transgender activist called Veronica Ivy (who changed her name from Rachel McKinnon for some reason), has argued that the relationship between T and sports performance is flawed. Ivy was born a man but transitioned to a woman and went on to compete in cycling and become a World Champion. Do you think she may have some ulterior motive here?

Other sports stars are more honest. The former tennis champion John McEnroe commented that while Serena Williams is the best female tennis player in the world, “if she played in the men’s circuit she’d be like 700 in the world.” Despite the subsequent controversy over McEnroe’s comments, Serena Williams admitted that she would lose to male tennis players.

To show why T gives men an advantage over women in sports, Carole Hooven presents the fictional boy-girl twins Samuel and Sofia as an example. Sam and Sofia compete against each other in sports but after puberty Sam always has the advantage over his sister.

This is the same for men and women in general. According to Carole Hooven, in 2019, 2500 men beat the fastest women’s time in the 100m event and women’s world records are around 10% lower than men’s. This is why men and women rarely compete together:

“Without segregation, it’s not just that men would win – women would never even qualify for the competitions in the first place.”

Veronica Ivy, however, has argued that the performance gap between men and women is closing. Carole Hooven states that this is incorrect. There are others like Veronica Ivy who are just as stubborn against the facts. A psychologist called Beth Jones appeared on the BBC Radio 4 show Woman’s Hour (a very feminist-friendly programme) to discuss transgender athletes and argued that women could improve by competing against men!

Similarly, Rebecca Jordan-Young and Katrina Karkazis, mentioned in Chapter 1, have argued that T is not an indicator of performance as athletes with the highest T levels do not always win competitions. The author counters by pointing out that this is within athletes of the same sex rather than between men and women so this is a “bait and switch” tactic by Jordan-Young and Karkazis.

Nevertheless, it is true that T levels vary between individuals and even then are not static. We have higher T in the morning than at night and T levels decline as we age. Physical activity will also reduce T levels for a period. Levels of T are often measured from extracts of blood or saliva but this is not without complications. Most of our T is bound to carrier proteins and only 2% is unbound or “free” so the levels of T measured may include both kinds. Additionally, measuring levels in women is more difficult than in men because other androgens in women may increase T level detection.

Again, there is scepticism about T in this domain. Sari van Anders, from Queen’s University, Canada, claimed that men and women’s T levels overlap and the binary is purely political. It won’t come as a shock to learn that Sari van Anders is involved in transgender activism. Ms. van Anders’ argument is contradicted by studies of T levels detected using mass spectrometry (MS), what Dr. Hooven calls the “gold standard” of T measurement. The endocrinologist David Handelsman did a meta-analysis of studies of T measured using MS and found that there was no overlap in T levels between men and women. This is shown in the book by the graph drawing below:

This is in contrast with height differences between the sexes where there is overlap. These studies only measured healthy men and women however. Would the distribution of T levels be different if, say, DSD conditions were included? A study by Richard Clark measured T levels including those with DSD conditions like CAH and 5-ARD which have been described previously. Conditions like CAH and polycystic ovarian syndrome (PCOS) lead to increased androgen production so will have some effect on T levels. However, even this does not cause overlap between men and women as seen below:

The author returns to her hypothetical twins Sam and Sofia to discuss how they would have developed in the womb and then in adolescence. Chapter 4 explained how males are exposed to T in the womb years before boys experience an increase in T during puberty. There is also an increase in T shortly after male babies are born which has been called a “mini-puberty” although the reason behind this is not well understood. Puberty is of course where boys and girls start to diverge more clearly. This is initiated by the hypothalamus in the brain.

The hypothalamus releases gonadotropin-releasing hormone (GnRH) which triggers the pituitary, also in the brain, to release lutenising hormone (LH) and follicle-stimulating hormone (FSH) into the bloodstream. LH and FSH would stimulate the release of hormones from Sam’s testes and Sofia’s ovaries respectively. The T released in Sam’s body leads to changes such as increased muscle growth, increased bone growth and heightened haemoglobin levels. In contrast, Sofia would experience more fat generation than muscle. This inevitably has an effect on how well the twins would perform at sports. After puberty, Sam would be able to outcompete Sofia easily.

Carole Hooven also explains that women with PCOS, which increases T, were found in one study to be over-represented in elite sport. 37% of Swedish female Olympians had PCOS which is three times the population rate. The mainstream media also regularly reports DSD women athletes as having “naturally high T levels” without mentioning their DSD condition, which may mean the athletes have XY chromosomes and male genitals! Complicating matters is the fact that the benefits of T, like muscle and bone size, would remain even if athletes like Caster Semenya were to take drugs to lower their levels. The author writes that she is unsure how to resolve the problem of DSD and transgender athletes since neither side of the argument will be completely satisfied. But, Caster Semenya and others like her should be treated with respect.

Chapter 6: T and Mating

Years after her trip to Uganda to observe chimpanzees, Carole Hooven visited the Scottish island of Rum to observe its abundant red deer population.

During mating season, called the “rut”, male stags will compete against each other to mate with females, called hinds, which the stags guard in harems. A few stags will have harems of hinds whilst other stags will have none.

One stag, named by the researchers there as “Wisdom 11” – the name of its mother, Wisdom, and the year it was born, 2011 – was particularly successful in mating. This was because Wisdom 11 was big, strong and healthy which meant he could challenge other stags and dominate territory.

However, other stags without harems may attempt to mate with hinds behind a successful stag’s back, earning the less successful stags the name “sneaky fuckers.”

Another stag, named Tattler 06 (mother Tattler, born in 2006), challenged Wisdom 11 by approaching and responding to Wisdom 11’s roars by roaring back. Other stags may have backed off when met with roars. At this point, the two males did not engage in fighting:

“Like most people, red deer stags don’t make a habit of recklessly jumping into a physical conflict. Fighting is risky and draining and is best reserved for when the rewards – usually hinds or increased dominance that might help to get hinds later – are worth the risk.”

In short, stags prefer to intimidate rivals by roaring instead of engaging in combat with them which could be harmful. Roaring is also an indication of dominant stags’ size, strength and therefore fighting ability. A rival who roars back to challenge a dominant male may eventually back off, but Tattler 06 remained. This ramped up the challenge. Both Tattler 06 and Wisdom 11 moved towards each other and battled with their antlers. If one stag can force the other to the ground, the stronger stag will force its antler tip into the weaker stag’s flank to injure it. Afterwards, the fight starts again. The author writes:

“It all struck me as rather gentlemanly. No cheating, no funny stuff. They were following all the rituals on the road to battle I’d read and taught about for many years.”

Wisdom 11 ultimately won the challenge as Tattler 06 eventually backed off. Carole Hooven witnessed similar skirmishes during her short stay on the island. Wisdom 11 even challenged another harem holder called Glariola 09 and ended up winning and taking Glariola 09’s four hinds!

Similar to the chimpanzee Imoso in Chapter 1, stags may attack hinds who stray or are unresponsive to mating. Hinds are less aggressive than stags because, as Carole Hooven puts it, they are not competing for a “reproductive jackpot.” Compared to dominant males, females will not produce as many calves so there is minimal competition between hinds.

Outside of mating season, male red deer do not compete for females and the sexes live separately. Stags’ testes “shut down” leading to a drop in T levels and their antlers fall off. The author calls this a “temporary castration.” Antlers start to grow again after the old ones have fallen off but are covered in a velvet-like coating to supply blood to the new ones. When mating season comes round again in the autumn, T levels increase resulting in changes in the body once again. As with other animals, T exposure in the womb works on stags to allow for changes later in puberty. Similarly, during mating season, increase in T allows for changes to occur in stag bodies without any complications.

Increase in T affects stags in the following ways:

  • The “antler velvet” that supplies blood for regrowth is shed to reveal the new antlers.
  • Increased calcification of bone which makes stags stronger, particularly the antlers.
  • Increased muscles around the neck which are used for fighting.
  • Increased shaggy mane around the neck to make the stags more intimidating.
  • Increased red blood cell production which increases oxygen transport and stamina.

Like what has been described in earlier chapters, Carole Hooven presents experiments that have been carried out on the Rum stags to discover the effects of T. In one experiment in the 1970s, stags were castrated at different times of the year – in and out of mating season – to see what effect this would have. Castrated stags lost their antlers and the regrown antlers remained covered in velvet and weak. Essentially, the body changes listed above that follow T increase were absent – no extra neck muscle, no shaggy mane, etc.

The absent T was then replaced in the stags using slow release capsules during mating season and outside of it to see if this had any effect. The stags returned to normal mating behaviour when hinds were fertile but did not show “rutting behaviour” outside of it. The author suggests other “cues” need to be present for the stags to engage in a rut such as seasonal changes. However, outside of mating season, stags with elevated T will still fight with other stags to display dominance.

A key motivator for stags fighting for dominance, like with other males, is to gain access to females. Females prefer to mate with dominant males over weaker ones. This is the underlying theory of ‘sexual selection’ which can be divided into male-male competition and female mate choice.

The author writes:

“The quintessence of this kind of sexual selection by “mate choice” is the peacock, with his train of long, brilliantly colored and decorated feathers. The peahen’s backside, by contrast, looks stunted and dull.”

Charles Darwin theorised that the ornamentation of male birds like the peacock is a result of female mate choice in his book The Descent of Man, and Selection in Relation to Sex.

“When females actively choose certain males for mates, whether it be the beautiful, bold, melodious, mean, or fragrant, her “decisions” are likely to be forceful drivers of the evolution of his secondary sex characteristics”

If you’ve read my review of The Ape That Understood the Universe, you might have seen my mention of an alternative theory that raises questions about this theory of sexual selection in peacocks. Although it’s nearly a year since I wrote that review, I’m still planning on writing about this alternative theory and hopefully posting it very soon.

Aggression and dominance are not restricted to males, however. Females of other species who fight each other for dominance include naked mole rats, spotted hyenas and meerkats. For the most part though, females tend to be less aggressive than males as there is usually less benefit for them.

This chapter also describes other animals that have similar breeding seasons to the stags on Rum. Arizona spiny lizards also have a breeding season in the autumn but male T regulation is not as up and down as that of stags. Just after mating season has ended during winter and spring, the lizards have low T levels but this increases during summer before the new mating season.

Male lizards will begin showing displays of dominance towards other males such as bobbing their heads in the summer before females come along in the autumn. Carole Hooven writes that T is at the “Goldilocks level” – in other words, is “just right” before autumn when T levels will increase. Why do these lizards have an intermediary period of T levels between mating seasons? Wouldn’t having high T levels be advantageous, even in the summer?

Again, experiments have been carried on these lizards to observe the effects of T on behaviour. Predictably, castrated lizards show no interest in females and are not aggressive or territorial. In contrast, lizards given T during the summer increase their territorial and dominance displays. While this would suggest the high T lizards would have the upper hand going into mating season at the end of summer, apparently 50% of the high-T lizards had died by this point compared to 20% of the ordinary lizards. The high-T lizards “came out of the gate too fast” – i.e. used up a lot of their energy guarding and patrolling their territories which made them vulnerable. Conversely, normal lizards saved their energy for the autumn and spent time resting and eating instead.

Male birds go through similar cycles of T but their mating behaviour is slightly different. John Wingfield, an evolutionary biologist who has studied birds (Carole Hooven notes his name is appropriate) found that song sparrows in the US have fluctuating T levels depending on if they are competing for females or providing for females and their chicks.

Like many species of bird, song sparrows will pair up for a season to look after their offspring and the males’ T levels will drop during this period. Males who were given an increase in T spent more time guarding territory and competing for new females instead of looking after chicks. Like with the spiny lizards, having “Goldilocks level” T is important for mating.

Elevated T does have its uses in this scenario however. Caged male birds placed in a wild bird’s territory will cause the wild male to confront and attack the caged bird who it perceives as a threat. As expected, the wild male bird’s T levels go up when responding to an intruding male. This has been called the “challenge hypothesis.” This response enables the males to protect their territory and their ‘family’:

“In short, T levels fluctuate depending on whether a male needs to be ready to breed, care for his family, or fight off rivals.”

Chapter 7: T and Violence

Chapters 2 to 6 are very solid in terms of scientific information and insight highlighting Carole Hooven’s qualities as an academic. The final four chapters (8 to 10 will be covered in Part 3) explore in more detail the role of T in explaining human behaviour.

It is at this point that the book dips a little bit in quality in my opinion as we get into more social commentary. That doesn’t mean these remaining chapters are not worth reading though.

The aggressive, dominant and territorial behaviour that is evident in male animals when T is increased has obvious parallels with human behaviour and particularly male violence. The chapter starts by describing an incident that happened to the writer Daemon Fairless, author of the book Mad Blood Stirring: The Inner Lives of Violent Men. During one New Year’s Eve in the subway of Fairless’ home city Toronto, a drunken young man was attempting to open the train doors which resulted in Fairless confronting him. The confrontation escalated into the two men getting into a fight. Carole Hooven notes that this incident would rarely play out between two women.

This inevitably leads to exploring “toxic masculinity.” The anthropology professor Matthew Gutmann has studied masculinity for many years and wrote the book Are Men Animals? How Modern Masculinity Sells Men Short where he argues that male violence and aggression can be largely explained by socialisation rather than biology. According to Carole Hooven, Professor Gutmann believes there is “little relationship with T and aggression.” In this way, his argument is similar to modern perceptions of sex differences being a product of nurture rather than nature. Moreover, the American Psychological Association has put forward the idea that male aggression is a production of “gender role socialisation” which is aimed at upholding “patriarchal codes” by requiring men to act dominantly.

Carole Hooven, of course, believes that these assumptions are incorrect and, in fact, T and biology do play a role in male violence. As shown in Chapter 6, one reason for aggression in males is to compete for females. Nevertheless, Dr. Hooven concedes that not only men can commit acts of violence:

“it would be a mistake to think of women as incapable of promoting – and sometimes of carrying out – extreme acts of violence. In 1994, during… genocide in…Rwanda…Pauline Nyiramasuhuko was the minister for Family Welfare and the Advancement of Women. She was later convicted of charges of genocidal rape. One witness recounted that right after Nyiramasuhuko ordered militia members to burn seventy women and girls using gasoline she had in her car, she said, “Why don’t you rape them before you kill them?””

Intimate partner violence (IPV) statistics also present conflicting and controversial facts about the prevalence of violence between men and women. Helen Gavin and Theresa Porter report in their book Female Aggression that wives are more often perpetrators of physical assault in relationships than men according to a study from Detroit. Similar results have been found in cities like London, Budapest and Stuttgart.

Here Carole Hooven reveals a weak spot in her thinking, in my view at least, and we get to one of the low points of this book. While I would broadly agree with Helen Gavin and Theresa Porter’s findings, Carole Hooven instead responds:

“When I first learned of this evidence, I was skeptical. It ran contrary to everything that I thought I’d learned about domestic abuse, and it was hard to imagine women as significant perpetrators.”

Dr. Hooven goes on to say that because women are generally physically weaker than men, they are less likely to inflict damage than men are on women. This is important to consider when discussing IPV, but the point is whether its prevalence is heavily skewed in one sex or the other, notwithstanding if men can inflict more damage than women.

The author also describes how empathy may play a role. Below is my least favourite passage from this book, and probably where I would disagree with Carole Hooven the most:

“Empathy is our ability to understand how others are feeling, and men are less able to do this than women, across cultures. This is a widely replicated and consistent finding, and it’s not true just of human males and females. In chimpanzees, bonobos, gorillas, elephants, dogs, and wolves, researchers have observed that males engage in lower rates of behavior related to empathy, like caregiving, cooperating, helping, and comforting.”

Carole Hooven might as well be saying here that “women are just better people!” although I don’t think she actually believes that. The point that females tends to do more caregiving and comforting is true, but this to me is like saying that extroverts are more empathic than introverts since extraverts prefer to be socialise and be around people whilst introverts may prefer to spent time by themselves. As far as I can tell, reports of empathy seem to rely on self-assessments and so could be considered subjective.

A few months ago, I retweeted this comment on one of Jordan Peterson’s tweets. The commenter noted that the word ’empathy’ didn’t exist until the early 20th Century and thus psychological study was biased towards a concept that humans beforehand had not even given a word to. It would take me too long to explore this further here, but I think ’empathy’ is often used to put forward the ‘women good, men bad’ viewpoint. Even when empathy is considered to be a flaw, the reasoning follows what I would call the ‘women are too nice for their own good argument.’

Dr. Hooven even suggests that violent men’s “reduced empathy” makes male-perpetrated IPV worse than female IPV. By this logic presumably, when a woman attacks her husband or boyfriend, it’s from a place of empathy and compassion, unlike that of nasty men.

Carole Hooven also mentions Margo Wilson and Martin Daly’s theory that most female violence is self-defence which I discuss a little bit in my review of Bad Men. Let’s just say I’m wary of that idea as well. I may have my own bias in rejecting these arguments, but they still strike me as simply “mental gymnastics” to explain away any understanding of IPV that doesn’t fit the ‘female victims, male perpetrators’ narrative.

Overall I found this part of the book disappointing. I realise that Carole Hooven is a public figure and I’m not, and that she’s a biologist rather than a psychologist, so we can be somewhat lenient towards her stance here since she’s likely relying on conventional wisdom. I don’t expect her to align 100 percent with my own views either. Furthermore, none of this takes away from what she has written before or her merits as a teacher.

With that out of the way, I’ll return to the book.

The author does point out women and girls are not necessarily less aggressive than men, but are instead more likely to engage in indirect aggression. Aggression itself can be divided into two categories: “reactive aggression” and “proactive aggression.”

Reactive aggression is instantaneous and often a response to triggers that make someone angry or threatened. It is more common between two individuals. Proactive aggression is more calculated such as planning an attack. It is more common in groups or institutions such as the military. The book claims that neither sex has a monopoly on either kind. The relationship with T and reactive aggression is clearer than T and proactive aggression and is the main focus of this chapter.

Measuring aggression can be difficult but one option is to study violent crime statistics since these are more likely to be recorded. As mentioned in Chapter 1, men are more likely to commit violent crime than women. Most murders, for example, are male-on-male. Other evidence includes studying male skeletons unearthed by archeologists which are more likely to show death by violent conflict. The author writes:

“The more risky, extreme, and cruel the violence, the larger the sex difference, and the greater the proportion of male offenders.”

Physical aggression by men is more beneficial than it is for women, as shown in Chapter 6. Adaptations for aggression in males is evident in the fact that men are generally bigger and stronger than women, take more physical risks and engage in more rough and tumble play in childhood.

Aggression and violence are correlated with T so rising and falling levels will have an effect. There are two situations where T levels in males are particularly sensitive: those relating to sex and those relating to violence or threat.

Humans and one of our closest relatives, chimpanzees, are not seasonal breeders like the animals described in the previous chapter. This means that the testes, in Carole Hooven’s words, “are always on the go.” The T levels of males in many species are usually highest when females are fertile. In female chimps, fertility is ‘advertised’ by “sexual swelling” of their backsides. For humans, however, this is different as women’s ovulation is concealed. The author suggests this is one reason men stick around even when women are not pregnant although also notes that children are more likely to survive if fathers are around as well. T levels in men will alternate depending on if they are trying to attract a woman (high) or if they are in a relationship and have children (low or at least lower).

Violence is usually a last resort tactic in animals because of the costs that go along with it, reflecting the confrontation between the two stags described in Chapter 6. The threat of violence allows stable hierarchies to form within groups, such as in primates, with the dominant primates being able to assume power over weaker ones. Similarly, men in smaller societies such as hunter-gatherer types would know their place within a hierarchy based on similar kinds of dominance. The more successful men will rise though the hierarchy based on their abilities as a hunter. The book notes that T levels are not only determined by biology, but are also situational. For example, in response to danger, a man might become bold and face it or afraid and flee – i.e. the ‘fight or flight’ response. The divergent reactions are related to T as an increase will usually result in the more bolder response. Alternatively, fleeing may result in a drop in T.

Biological differences may explain how T changes result in differing responses between individual men. The androgen receptor, which T binds to, is more effective in some men than others. This likely explains why some men, for instance, can grow beards easier than others and are stronger and more aggressive. Studies have found that the DNA sequence in the androgen receptor gene has a repeat of C-A-G bases or “CAG repeats.”

If you are not familiar with DNA bases, there are four types, called adenine, cytosine, guanine and thymine or A, C, G, T (not to be confused with testosterone). Adenine joins to thymine and cytosine to guanine to form the DNA double helix. A DNA sequence consists of the four bases so a “CAG repeat” may look like this:

CAGCAGCAGCAGCAGCAGCAG…

These bases would join together with a sequence that looked like this:

GTCGTCGTCGTCGTCGTCGTC…

Hopefully that will make the following clearer.

Having fewer CAG repeats in the androgen receptor gene means that the receptor will be more effective and therefore show a greater response to T. This has downsides however as fewer CAG repeats is linked to a higher probability of getting prostate cancer and “spontaneous abortions” in pregnant women. Men with short CAG repeats are said to get more pleasure out of being aggressive. T release is also linked to the release of dopamine which influences motivation and reward.

According to Dr. Hooven, T reduces empathy since motivation and reward are increased and fear and the perception of pain are decreased. Despite my reservations about the author’s earlier claims about empathy, I have to concede here that there may be something to this. It makes sense that violence and risk-taking require detachment to some degree in order to focus on the violence/risk being undertaken. On the other hand, we could debate whether ‘detachment’ and ‘decreased empathy’ are the same thing. I still think empathy is a vague term that should be debated.

Nevertheless, T does not always stimulate excessive violence. The endocrinologist Robert Sapolsky has studied aggression in animals such as talapoin monkeys in his book The Trouble with Testosterone. A study in which talapoins were given an increase in T led to more aggressive behaviour but this was directed towards other talapoins below them in the monkeys’ dominance hierarchy rather than a violent free-for-all. Thus, T could be said to work as a ‘performance enhancer’. Carole Hooven explains:

“T is not a potion that turns the meek into warriors or that causes rampant bellicosity. Its effects depend heavily on individual and environmental factors, and in humans especially, winning and achieving high status can often be accomplished without any physical aggression at all. T tends to do what the situation requires.”

The male body must therefore be able to undergo “rapid T changes” in order to react to an unpredictable situation. According to Carole Hooven, it is not known at present how the body can respond so quickly to these rapid changes since it takes time for T to bind to a receptor then move into a cell nucleus to stimulate gene transcription. One possible explanation is that T acts like a neurotransmitter and interacts with the cell surface as well.

The author concludes this chapter by pointing out that culture has an effect on the prevalence of violence. In Singapore, for example, there are very strict laws which has resulted in a low crime and murder rate. Carole Hooven writes:

“Frank talk about T will help us appreciate how changes in the environment can rein in problematic male behavior.”

Is it only men who are the problem though? It’s one thing to accept that men commit most crimes and violence, but we shouldn’t assume that women are either innocent victims or simply bystanders because of this. Since male violence may result in an increase in status, power and resources, why should we think that women would have nothing to do with it? The idea that anything that is male-dominated will only benefit men is what I call the “by men, for men fallacy” which I might write about at some point.

Here are some other interesting facts from this chapter:

  • Personality likely affects how men may react to a threat to their status and reputation. “Dominance-oriented” men who are also impulsive are more likely to respond to increased T with aggression.
  • Rapid T level changes have been observed in sport as levels will fluctuate in response to a win or loss. During the 1994 FIFA World Cup final (Italy vs. Brazil), which was held in the US, researchers from Georgia State University collected saliva from Italian and Brazilian football fans before and after the match to measure T. Following the match, the T levels from the Brazil fans stayed the same or increased whereas the levels in the Italy fans declined. This was because Italy lost and Brazil won.
  • Similar effects to winning and losing have been tested in women. However, there is scant evidence that T mediates female competitiveness. It is possible though that other hormones may be involved instead.

This review will be concluded in Part 3.

2 thoughts on “Book Review: ‘Testosterone: The Story of the Hormone that Dominates and Divides Us’ by Carole Hooven (Part 2)”

  1. As always, a thoughtful review. I agree with your comments about empathy and it seems to me that this was just a throwaway remark by the author. I suspect empathy takes different forms in men and women. When the relationship of the daughter of a married couple I know ended acrimoniously the mother certainly did the more gushing stuff, but the father responded in different ways, appreciating what practical problems she would face, he fixed her car and sorted things around the house to make her life as easy as possible. They both felt her pain but responded in different ways. The problem with some anthropological studies is that female observers decide what behaviors constitute empathy.
    It is also worth remembering that too much empathy, as opposed to compassion, is not always a good thing. I recommend the book – Against empathy: the case for rational compassion by Paul Bloom.

    Like

Leave a comment