MMM#13: Are Women Being Erased?

Since Holy Pride Month has come and gone, I thought I’d write about an issue that currently dominates LGBT discussions.

Controversy around transgenderism continues to appear frequently in the news: the comedian Ricky Gervais’ latest stand up special included a segment in which he mocked issues such as transgender access to women’s toilets, the Labour MP Stella Creasy gave a bizarre interview for The Telegraph newspaper in which she argued that women can have a penis, the conservative commentator Matt Walsh has released a documentary entitled What Is a Woman? and Jordan Peterson had his Twitter account suspended for a comment he made about the trans actor/actress Ellen/Elliot Page.

The ongoing conflict regarding transgenderism has led some to conclude that women, in particular, are under threat since we seem to be unable to define what a woman is. For example, Brendan O’Neill wrote an article in The Spectator back in 2017 arguing that the word ‘woman’ was being erased from public life.

Similarly, the American conservative organisation The Heritage Foundation wrote about the erasure of women escalating in this piece. However, it has been noted that, since the overturning of Roe vs. Wade by the US Supreme Court, progressives have suddenly remembered what a woman is!

Are we heading towards a dystopia in which nobody can tell the difference between men and women and in which women themselves will be erased as a recognised group altogether? My own feeling is that this is highly unlikely.

While I like Brendan O’Neill’s content for the most part, it should be noted that five years have passed since he wrote his Spectator article and the word “woman” still remains in use in public, although the reader might argue that it too soon to argue against this claim.

A similar accusation is often made towards feminism wanting to erase all differences between men and women. There is truth in this, but I believe it is often overstated. Feminists can put forward the blank slate theory of human nature one moment and then suddenly notice differences between men and women when it suits them to do so. Obviously, this doesn’t mean there isn’t a problem as there is clearly confusion about how to define the two sexes.

Although I sympathise with many women’s concerns over issues like transgender athletes and the access that men who identify as women may have to female toilets and changing rooms, it should be noted that worries surrounding women and their safety have not exactly disappeared following the rise of the trans movement – #MeToo and the Sarah Everard case being just two examples in recent years.

It is interesting, after all, that even lesbian feminists like Julie Bindel (one of the more independently minded ones, admittedly) are on the same side as Harry Potter author JK Rowling in opposing the excessive claims of the trans rights movement. Again, while I agree with many of the arguments that so-called “trans-exclusionary radical feminists” (TERFs) like Ms Bindel and Rowling have made, my sympathy towards them is limited. This is because TERFs have been happy to push forward progressive ideas when these ideas benefitted women at the expense of men and have only objected to such ideas when they appeared to disadvantage ordinary women.

I have my own conspiracy theory that the trans movement was pushed forward by some feminists as a way to rejuvenate their own movement as many women no longer identified with feminism or, more accurately, considered themselves to be ‘post-feminists’ who had believed that feminism had run its course. The apparent threat of transgenderism in erasing women has helped feminism have a new cause to fight against even if it involves a lot of infighting – although infighting is common in feminism anyway. I’m not saying my conspiracy theory is true necessarily, but it’s fun to think about.

Most of the anger coming from feminists on this issue is likely because they believe their slice of the victim pie has just got a little smaller. I can imagine many of the feminists campaigning against the trans lobby suddenly aligning with them and saying both have a common enemy in straight men and the patriarchy when it suits them.

I’ve seen a few people wondering why transgender issues appear to affect women more than men and why women seem to be in more danger of being ‘erased’. It is often concluded that misogyny is the answer. However, there are other reasons that can explain why transgenderism has affected women rather than men, such as:

  • Since men are, on average, physically stronger than women a man who identifies as a woman is perceived as more of a danger in an all-female space.
  • Women arguably have a stronger sense of identity than men so any issue that encroaches on female spaces will be considered a bigger deal. Even an issue that could affect male identity, e.g. a transman who is pregnant, will be seen as more of an issue that affects women for obvious reasons.
  • In some ways, femininity is more flexible about boundaries than masculinity as it is easier for women to cross boundaries defined by sex than it is for men. For instance, women have entered previously male-dominated spaces more frequently than men have entered formerly female-dominated spaces (notwithstanding the current transgender controversy). Similarly, women are more likely to be bisexual than men who typically identify more as either heterosexual or homosexual. Therefore, the current transgender issues are possibly a reflection of this flexibility in femininity working against women.
  • Male identity has already been made vulnerable by feminism – e.g. women moving into spaces which were once exclusively occupied by men – and this remains so regardless of transgenderism, which will also have some effect.

Our obsession with transgenderism is disproportional to the actual number of people who identify as trans or ‘non-binary’ in the same way that people often overestimate the number of people who are gay. This article suggests that 1% of people in the UK recognise themselves as transgender which amounts to slightly over 600,000 people although that estimate may be inaccurate since no everybody will be identified. Notice that ‘identify as’ is not the same as ‘are’.

In other words, although 600,000+ people is a lot, this is miniscule compared to the 60 million+ population of the UK. Even though these numbers appear to have increased, they are still comparably small. Similar findings are likely in other countries of comparable or larger populations. It’s possible that the pro-trans rights lobby would use this argument to deflect any criticism against them by accusing opponents of overreacting so my point here is in no way to dismiss the concerns women have about all of this.

Even in this age of supposed “gender fluidity”, most of the teenagers and young people I encounter are still recognisably male or female even though there is probably more who identity as “LGBT” or what the comedian Dave Chappelle calls “the alphabet people.” On the other hand, I am aware that there has been a concerted effort to push trans ideology on children at a younger and younger age.

But if the number of transgender people is so small, why are public figures such as Labour leader Keir Starmer unable to answer questions like “what is a woman?” The mealy-mouthed response from such politicians is indicative of their well known tactic of not answering a question directly. On the surface, it is obviously absurd that there are people who can’t answer a question like what a woman is but I believe the issue is not so much that they don’t know, but rather that they don’t know HOW to answer that question. It is similar to a child asking their parent “where babies come from”: the parent knows the answer, but not necessarily how to explain it.

Politicians, mainly on the Left, are caught in what the South Park character PC Principal would call a “PC pretzel” where they cannot give a definite answer without upsetting a certain group of people. There is also an element of ‘having your cake and eating it’ about all of this as I’ve noticed articles about pregnant women using “women” and “pregnant people” almost interchangeably as a way of covering all bases to avoid any controversy.

For all of the concern about not being able to identify women and women being erased, it should be noted that the obsession with women’s issues in the media has never gone away. For example, a recent drama appeared on TV called Maryland which was yet another lamentation about male violence against women.

At the heart of this controversy appears to be whether we can define ‘man’ or ‘woman’ in purely biological terms or on individual terms.

I could be too charitable here, but I imagine their encapsulation of “what is a woman” would look like this:

  • majority – adult who is biologically female (cis)
  • minority – adult who is intersex/not biologically female but identifies as such

A man who feels like a woman trapped in a man’s body may believe he is truly a woman even though biologically he’s not. While this could be seen as taking philosopher Rene Descartes famous statement “I think, therefore I am” way too far, in our age of all-inclusivity, even these minority cases are included in the group ‘woman.’ In this sense, Stella Creasy saying that a woman can have a penis – if a man genuinely believes he is really a woman born in the wrong body – has some logic if you define ‘man’ and ‘woman’ as terms that can be applied depending on how you perceive yourself,. but you have to do a lot of convoluted thinking to get to that point. Even if you don’t agree with the explanation I’ve offered here, it makes more sense than the incoherence spouted by the people interviewed in Matt Walsh’s documentary, which is reviewed here.

At best, we can say that human are made of two sexes, male and female, plus a grey area where trans and intersex people (such as those described in Carole Hooven’s Testosterone) occupy and whose numbers, as already pointed out, are few and far between.

In these circumstances, we have to weight the concerns of the majority group – so-called ‘cis-gender’ women – with the minority of those men, who for medical and/or psychological reasons, identify as women.

I think eventually Labour and other Left-leaning parties will have to take a clear position on this as they will lose support and votes if they continue to be ambiguous.

I’m willing to hold my hands up and admit I’m wrong if the dystopian, genderless society does come to pass, but for now I believe that reports of women’s erasure have been greatly exaggerated.

MMM#12: Johnny Depp and Amber Heard

Although it’s a little belated I thought I’d write briefly here about the Johnny Depp and Amber Heard trial which ended a few weeks ago and featured prominently in the news.

I looked at the news of the case only occasionally while it was ongoing rather than following it live as some people have done but I was interested by the amount of sympathy that was directed by many towards Johnny Depp, a man, over Amber Heard, a woman, which was in contrast to many cases of relationship conflict which tend to portray women in a more positive light.

Despite this being the age of culture wars and stark divides between people on a variety of issues, I was struck by how many people, regardless of their sex or political leanings, seemed to support Johnny Depp over Amber Heard. Who would have thought it would take a case like this for a consensus to be reached?

Of course, there were a few people who sided with Amber Heard and many more who were indifferent to the case and wondered what all the fuss was about.

I’ll admit that I was more on Johnny Depp’s side partly due to believing he had been a victim of the #MeToo hysteria but also because I have watched and enjoyed some of Johnny Depp’s films whereas the only Amber Heard films I knew were The Rum Diary (where she met Depp during the filming) and Aquaman and I’ve seen neither of them. Bias is always a danger in a case such as this as you can inadvertently mould facts to favour or disfavour whichever person you happen to be for or against.

Nevertheless, I understood people who took a more neutral position and thought both Depp and Heard were as bad as each other. Johnny Depp, given his excessive drug taking, is far from perfect and appears to be a poor judge of character. Who’s to say he won’t fall into another dysfunctional relationship?

It was encouraging to see women speaking out against Heard and the assumption that they should believe her because she was female although this may have been motivated by their fondness for Johnny Depp. Whilst looking at responses to the trial online I stumbled upon a woman who goes by the name ‘Colonel Kurtz’ (I’m aware that’s the character Marlon Brando played in Apocalypse Now), who has made videos defending Johnny Depp and, more controversially, the musician Marylin Manson who has been accused of sexual abuse by his ex-girlfriend Evan Rachel Wood.

I was particularly interested by this 1 hour 45 minute video that Colonel Kurtz made over a year ago in which she analyses a number of Amber Heard interviews to explore Heard’s possible psychological problems. This video also features the very creepy looking Elizabeth Holmes who was behind the Theranos scandal. Later I retweeted Colonel Kurtz’s tweet noting that people’s interest in Amber Heard was partly because Heard represented the reality of false accusations by women (in Kurtz’s opinion at least) against men which had been denied by the media.

The idea that psychologically damaged women could use #MeToo to peddle false or exaggerated accusations of abuse by men was not something many journalists were comfortable with. It was amusing to see the mainstream media contort themselves into trying to make Amber Heard the innocent victim being bullied and harassed by online trolls which was illuminating in how reporting is driven by narratives instead of facts. At the time of writing, Amber Heard has continued to portray herself as the victim in public appearances following the verdict being ruled in Johnny Depp’s favour.

That being said, there was an element of a media circus being created to air the couple’s dirty laundry for the audience’s amusement and for us to observe how messed up Hollywood celebrities really are. On the other hand, the broadcasting of the trial did show the benefit of being able to observe a legal dispute between a man and a woman which allowed the public to see how both parties presented themselves rather than having to rely on potentially biased accounts by the media. I believe that most of the support that Depp received was down to him coming across as more genuine than Heard as well as having a far more competent legal team.

The Depp/Heard trial can be compared to other ‘he said, she said’ trials for more serious offences like rape. In discussions over how to handle rape prosecutions, there is often a debate about whether accusers should be allowed to be anonymous while the accused is named or whether both or neither side should be given anonymity.

I used to think that both the accuser and accused should be given anonymity but I’ve started to think it would be better if neither party was anonymous since it allows a neutral observer to decide for themselves who they think is telling the truth. Inevitably, there will be people who instinctively side with one person over the other but it seems better than allowing such controversial cases to occur behind closed doors. I doubt the suggestion that anonymity should not be allowed in rape cases will gain much traction though since the old excuse of “this will prevent victims from coming forward” will be argued by the growing number of people who seem to think “accuser” always means “victim”.

If the Marylin Manson case features prominently in the news, it will be interesting to see if there is a similar reaction to what has occurred with Depp vs. Heard. However, since Manson is not as well known or as well liked as Johnny Depp, I don’t believe the same amount of support will be present.

If there is one positive outcome to the Depp/Heard trial, I think it is that a lot more people, whether they are men or women, have become more sceptical about #believeallwomen and #MeToo.

Book Review: ‘Testosterone: The Story of the Hormone that Dominates and Divides Us’ by Carole Hooven (Part 3)

Chapter 8: T and Sexuality

There’s a story about the US President Calvin Coolidge and his wife touring a poultry farm and being shown around separately. The story might be fictional, but it forms the basis for a joke. The gist of it is that the farmer tells Mrs. Coolidge that the rooster can mate frequently and vigorously to which she replies, “Tell that to Mr. Coolidge.” When Calvin Coolidge is told about the rooster, he asks if it mates with the same hen or with different ones. The farmer tells the President that the rooster mates with many different hens, to which Calvin Coolidge responds, “Tell THAT to Mrs. Coolidge.” This story, whether true or not, inspired the naming of a phenomenon called the ‘Coolidge effect’.

The Coolidge effect is when a male whose sexual interest has declined after mating will experience a renewal in interest when it encounters a new female. This has been observed in many different animals. I was aware of the effect before reading this book but I’m surprised that it was not explored in either of Steve Stewart-Williams’ and David Buss’ books. Carole Hooven suggests that the Coolidge effect may have been an adaptation in males to take advantage of a mating opportunity which could be costly if not pursued. The neurotransmitter dopamine, which is involved in motivation, and T are both involved in creating and recreating this sexual interest.

The description of this effect introduces the theme of this chapter: how T influences sexuality and sex drive. A well known difference between men and women, for instance, is that men typically have a higher sex drive and a greater desire for more sexual partners than women. Evidence for this includes men’s greater consumption of prostitutes and pornography. Studies have also shown evidence of the Coolidge effect in men watching pornography as sexual arousal increases when a new woman is introduced. T is partly responsible for this difference between the sexes.

Sexual and romantic interest emerges at puberty with the release of sex hormones in boys and girls. Boys, of course, will experience a sharp increase in T levels unlike girls. As already established in previous chapters, the T rise in boys influences the parts of their brain that have already been exposed to T in the womb and immediately after birth. Girls experience a release of oestrogen and progesterone instead of T but, in either case, the majority of boys and girls will become attracted to the opposite sex following puberty.

Carole Hooven points out that culture has an effect on sexual behaviour as well. Sexual practices and attitudes can differ all around the world depending on a particular society’s customs. For example, oral sex by boys on men in the Sambia of Papua New Guinea and polygamy among Mormons in the United States is/was acceptable despite both activities been condemned in many other cultures. Attitudes towards homosexuality also vary from being accepted (some might say to an excessive degree) in Western countries and rejected (again, perhaps to excess) in regions such as Africa and the Middle East. Regardless of these factors, the difference in men and women’s sex drive is a consistent finding cross-culturally which indicates that biology is involved.

The reason for the difference in sex drive and sexual variety between males and females has already been partly explained in Chapter 6 with the stags on Rum: males who compete and obtain the most females can increase their reproductive success. By contrast, females have no greater reproductive success competing for a harem of males.

However, Chapter 6 also shows that males of different species will vary in their behaviours. Rum stags are not involved in caring for their offspring whereas male birds will pair bond with females to care for their young. This is because deer calves can survive without any paternal investment whilst birds are helpless as chicks. Similarly, human babies are completely helpless when they are born unlike deer who can walk a few hours after birth. Like birds, humans pair bond to care for offspring.

Carole Hooven writes:

“Not surprisingly, women tend to prefer mates who don’t just have high social status but who also signal willingness to invest in them and their children. Men who fail to signal these qualities and who are just out for a good time may have a harder time finding healthy, fertile mates because women are exercising their reproductive choices.”

There is logic to this but pick-up artists (PUAs) may well disagree with what Carole Hooven claims here. Whether or not you approve of what PUAs do, these men have been successful in attracting women without necessarily signalling to such women they are going to invest in her or her children. Furthermore, how many young women are simply “out for a good time” like men? Moreover, there are men who have fathered children with different women despite not sticking around afterwards.

The author notes that men benefit from staying to raise offspring since, like birds, paternal investment increases the likelihood of babies surviving. T levels will vary depend on if men are trying to attract women or in a committed relationship as previously explained in the book. Men in a relationship or caring for offspring will have lower T:

“Lower T in this situation is associated with being a more devoted partner.”

Again, there is logic to this but women may be less attracted to men who have decreased T. Also, low T has disadvantages in men such as low energy and possibly depression which is not good for relationships.

Similar to the “challenge hypothesis” explained in the sixth chapter, men who have children can experience a rise in T in certain situations such as hearing their baby crying which is possibly to trigger a protective response.

In my opinion, the T levels of men who are single or in a relationship are at what the author has previously called the “Goldilocks level” or “just right” rather than being simply high or low. Carole Hooven noted in the beginning of the book that we typically associate T with men even though women also have T so talking about “high T levels” and “low T levels” can come across as saying “more male” or “more female”. In other words, if men have low T in relationships, this could be seen as being “more female” and therefore better than “more male” high T.

This chapter also analyses the role T may play in influencing sexual orientation. The book claims that the only exclusive homosexual behaviour observed outside of humans is in male domesticated sheep although does not state whether this is in the presence or absence of females. However, Chapter 4 showed that hormonal exposure can affect sexual behaviour such as female rats exposed to T in the womb and in adulthood engaging in mounting which is a predominately male trait.

Although human homosexuality is more complicated, Carole Hooven points out that the stereotype of “lesbian mechanics and gay flight attendants” – i.e. homosexual men and women exhibiting behaviour typical of the opposite sex – has some truth to it. Lesbians and gay men are more likely to identify themselves as less feminine or masculine respectively and are more likely to be in professions that are atypical of their sex.

In childhood, girls who identify as lesbian when they grow up are more likely to show typical boy behaviour such as rough and tumble play and playing sport while boys who identify as gay later on can behave in more female-typical ways.

If T plays a part in developing sexual preferences, it appears to have more of an effect on females than males as there is more evidence of increased T creating lesbian-typical traits than low T creating traits typical of gay men. For example, girls with CAH (mentioned in Chapter 4) are exposed to high levels of T in the womb and are more likely to behave like boys and be attracted to women when they grow up. Nevertheless, Carole Hooven concludes that is unclear if T influences sexual orientation as it is difficult to measure the amount of T that babies may be exposed to in the womb and we do not know exactly when fetal brains differentiate to become male or female.

Although some gay men may identify as less masculine than heterosexual men, gay men are more likely than lesbians to engage in casual sex with many partners, tieing in with the earlier point of men preferring sexual variety more than women.

The author writes:

“In comparison with their straight cousins, on average, gay men do have many more sexual partners. Lesbians do not, and are much more likely to be sexual within committed monogamous relationships.”

Like Steve Stewart-Williams, who makes a similar point in his own book, Carole Hooven does not mention that married lesbian couples are more likely to divorce than other couples so shouldn’t necessarily be seen as the gold standard for committed relationships. The point about sexual variety still stands though:

“Gay men have more sex simply because they can, it’s not a “gay” thing, it’s a “man” thing.”

Here are some other interesting points from Chapter 8:

  • It is unclear if T increases sex drive in women like in men since T is harder to measure in women. T and oestrogen also both peak around ovulation and vary during the menstrual cycle. Other factors such as age and cultural norms can also play a role. Women with conditions like CAIS (which means they are unresponsive to androgens like T) can show typical sexual responses.
  • “Digit ratio” of fingers may indicate the level of early T exposure in the womb. Men and women differ on average in the length of their index finger (the second digit or ‘2D’) relative to their ring finger (fourth digit or ‘4D’) which gives the digit ratio (2D:4D). Men and women’s index and ring fingers are either roughly the same length (which is the case for me, not that anyone cares) or one finger is slightly longer than the other one. In women, the index finger is more likely to be longer than the ring finger and vice versa for men. This means that women’s digit ratio will be higher than men’s. This relationship has been observed in utero and in other vertebrates. This is only a “noisy” signal of T – i.e. has some correlation but is weak – but could be useful to measure group differences. The image below might make this clearer.

Chapter 9: T and Transgenderism

In the book’s penultimate chapter, Carole Hooven explores men and women who have gender dysphoria or are “transgender” and how T may be involved in this. She interviewed several people who either “transitioned” female-to-male (FtM) or male-to-female (MtF) in addition to people who transitioned back.

The author notes:

“Trans people who drastically alter their T levels are in a unique position to offer insights into how life is different when they cross over the other side of the testosterone line.”

The number of people who identify as transgender has risen greatly over the past few years, partly in my view because of its ubiquity in political discourse. According to the book, in one review, the number of people in the US who identified as “trans” in 2017 was double what it was a decade earlier. Additionally, in the UK, referrals to the NHS Gender Identity Development have risen 50-fold.

The author mentions a couple of famous transgender cases such as Jazz Jennings, a MtF celebrity who was apparently diagnosed with gender dysphoria at age 3 and Buck Angel, a FtM celebrity who looks like, in Dr. Hooven’s words, a “heavily tattooed version of the action hero Vin Diesel.”

Given the dramatic effects “transitioning” from one sex to resemble the other can have, there are unique complications for both FtM and MtF cases.

As described in Chapter 5, the effects of T on the body of men, or DSD individuals like Caster Semenya, are difficult to suppress even with hormone therapy. The physical changes undergone during male puberty cannot be undone by increasing hormones like oestrogen.

Carole Hooven compares the difficulties of MtF transitioning to renovating a property. The parts of a property that require maintenance such as the decorating or gardening can be easily modified but the more stable parts such as the brick walls cannot be easily changed.

In the case of a male body transitioning to resemble a female body, the “brick wall” components such as bones, facial structure and vocal cords will remain the same in the absence of T and are difficult to change. Conversely, the “maintenance” components of the body like muscles, fat and reproductive system are less difficult to modify as they rely more on T.

As the author explains:

“Testosterone’s bricklike effects are the reason that physically transitioning in the male-to-female (MtF) direction is so much harder than the reverse (FtM).”

Dr. Hooven interviewed a MtF individual named “Kallisti” who began transitioning to a woman in his(her?) early 30s and the author points out the obvious difficulties:

“I had to make an effort to override the masculine signal her voice sent over the phone, and it was easy to see why this could make life difficult for Kallisti.”

Hormones act on the larynx or “voice box” which affects, amongst other things, the pitch and quality of voice. During male puberty, T binds to androgen receptors in the tissues of the voice box to strengthen and elongate them which increases the depth of voice. Only surgery on the vocal cords can alter this as hormones will have no effect. It is easier for a FtM individual to change their voice to be more masculine but this still might not be as deep as a normal male due to the different size and shape of a woman’s voice box.

“Laryngeal prominence” otherwise known as ‘Adam’s apples’ are more prominent in men than in women to the point where it is sometimes believed that women do not have one. Adam’s apples protect the vocal folds and are joined together by cartilage tissue at a sharper angle in men which is what causes the greater protrusion. During FtM transition, increasing T will lead to a slight growth in Adam’s apples.

High T also means more “terminal” body hair which is coarser and darker than soft, pale “vellus” hair. DHT, mentioned in previous chapters, is responsible for stimulating this hair growth. For FtM transitioning, hormone exposure will result in an increase in hair on the body and face. For MtF cases, it is more difficult to reverse the effects of androgens on creating body hair since terminal hair cannot be reversed back into vellus hair. Often procedures such as laser treatment are needed.

The changes that occur in male and female bodies during puberty makes it difficult for those with gender dysphoria to have the body that they believe correlates with the sex they identify with. “Puberty blockers” are used to prevent the natural development of boys and girls into men and women as a way for people who struggle with their sex identity to “buy time” and decided whether they want to transition or not.

As you can imagine, puberty blocker use has increased and is very controversial. Puberty blockers were originally created to treat children who suffered from “precocious puberty”, in other words, puberty that starts in children much earlier than it is supposed to. This fact reminded me of plastic surgery, which was originally intended to treat people who had been mutilated and disfigured but was then used for more controversial purposes such as cosmetics.

Carole Hooven interviewed a child called “Sasha” who is a boy who took puberty blockers and is a potential MtF case. Although Sasha preferred girls clothes and items over boy’s, he was reluctant to use feminine pronouns and identifies as “non-binary”.

From what Sasha tells Dr. Hooven during their interview, I get the impression that there may have been some outside pressure involved as well, as Sasha has been to “transgender sleep-away camp” for a few years and then went to a “gender clinic” after friends from the camp went to one. Here’s what Sasha said when asked about being offered puberty blockers:

“I was more leaning towards it, but not that much. So when they asked me, do you want a puberty blocker? I said, oh, maybe, maybe not. Not really sure…I had…five other meetings and…I was, like, “probably”, “most likely”, “yeah”, “I really want to…”

Sasha

Sasha does not want to go through male puberty but also does not want to completely identify as female. After taking a puberty blocker, Sasha claims that he may start taking oestrogen even though he is unsure he wants to. He would not mind having female traits, but does not want to have “male everything”.

Carole Hooven takes an impartial position, which is fair enough, but I think that Sasha may need counselling of some kind to ascertain why he feels the way he does rather than simply being placed on puberty blockers.

Puberty blockers tend to work “upstream” by blocking signals from the brain telling the body to produce sex hormones rather than directly blocking sex hormone receptors “downstream”. The most widely used puberty blocker actually activates the gonadotropin-releasing hormone (GnRH) receptor which is vital to trigger puberty.

This seems paradoxical, but the blocker triggers a constant response from the GnRH receptor rather than the normal response of gradual “hits” which are necessary to trigger a response from the pituitary. Constant activation rather than intervals of activation result in the pituitary no longer responding to signals from GnRH. Therefore, there is no sex hormone release.

The author explains that there is very little research on the long-term effects of blocking puberty in children with gender dysphoria as the practice is relatively new. There are some predictable outcomes however: children who have been given puberty blockers tend to be shorter and lack the physical development of other children going through puberty. Additionally, since puberty increases bone strength, blocking puberty could lead to permanently weak bones.

Although puberty will resume when children on puberty blockers stop using them, such children/adolescents will be “out of sync” with their peers which can cause emotional and psychological difficulties. Similarly, starting puberty later may not result in the same outcomes as normal puberty. Carole Hooven also notes that blocking puberty may reduce opportunities for gender-dysphoric children to explore their feelings about identity which is common for all adolescents.

According to the book, 95% of children who take puberty blockers will decide they want to transition and take cross-sex hormones. As already described, the effects of cross-sex hormones are less reversible than puberty blockers.

Dr. Hooven writes:

“When someone decides to hormonally transition, no matter their age, they are signing up for a lifetime of medical dependence on hormones.”

Fertility will also be affected depending on when gender-dysphoric children stop taking puberty blockers or start taking cross-sex hormones. Puberty may proceed long enough for sperm or eggs to be produced which could be harvested before transitioning.

Given the complexity and controversy around all of this, the author wisely argues:

“Particularly where blockers are concerned, parents and caregivers should consult with qualified professionals, preferably getting a second or third opinion…to provide the best support possible to young people who are making these life-changing decisions, much more research is required.”

This chapter concludes by exploring people who transitioned from one sex to the other before deciding to “detransition” and re-identify with their biological sex. Having been exposed to cross-sex hormones, both FtM and MfF individuals have experience about what it is like to occupy a male and female-typical body. Here are some of the changes that occur which reflect sex differences:

  • FtM and MtFs experience a change in libido. For example, “Alan”, who was FtM, noticed an increase in libido whereas Kallisti (mentioned before), a MtF, experienced a decreased libido but orgasms became a “whole body experience”. “Stella”, a FtM who detransitioned back into identifying as female, noticed an increase in libido which then decreased after stopping cross-sex hormones.
  • FtM cases like Alan and Stella noticed they cried less when taking cross-sex hormones like T. Their “emotional threshold” was higher. The author notes that women cry more and are more likely to have depression. I would point out here though that men’s suicide rate is three times higher than women’s.
  • Kallisti (MfF) became less physically angry after transitioning. However, Carole Hooven argues that changes in anger with or without T are no consistent:

“there’s no reason to think that T will turn a placid female-to-male transitioner into a hot-tempered Incredible Hulk.”

Although T obviously has an effect on the brains and body of those who transition female-to-male, as well as its absence in male-to-female individuals, it is not known if variations in T levels in the womb have any effect on whether a boy or girl will have gender dysphoria.

Nonetheless, there is some evidence that girls who had high prenatal T levels are more likely to have gender dysphoria, similar to the greater likelihood of high-prenatal T girls beings lesbians when they grow up.

Chapter 10: T and Conclusion

The final chapter of the book is also the weakest as it is essentially a summary of the content covered previously. Carole Hooven also weighs in on more social and political issues relating to T which, as I’ve already mentioned, is where the book is less convincing.

Dr. Hooven describes how both men and women are often frustrated by each other’s behaviour but, since men are the primary focus of the book, the attention here is on women’s feelings about men, or, as they may exclaim, “Men!”:

“My personal impression is that these somewhat playful “Men” sighs are a reaction to an objectifying sexuality, difficulties listening and expressing emotions, or ego insecurities that seem to motivate an unearned sense of confidence about, well, almost everything.”

The author does admit that this remark “has the ring of sexism” which is why women often only utter it around other women. The last point about men having “an unearned sense of confidence” is indicative of the idea that men and boys need to be ‘taken down a peg or two’ whereas women and girls alternatively need constant encouragement and support. Later, Carole Hooven also mentions men feeling “the need to confidently explain the obvious” which presumably refers to the idea of ‘mansplaining’.

I don’t want to come across as being too upset or ‘triggered’ by these remarks since there’s probably an element of tongue-in-cheek from the author here but a lot of this chapter does come across as Carole Hooven conveying the mentality of “how to solve a problem like men?”

Moreover, she suggests that understanding biology could be useful in helping to deal with societal problems like sexual assault, reflecting David Buss’ point in his book Bad Men:

“Solving problems requires understanding their causes. If we consistently downplay one set of potential causes (say, biological) in favor of another (say, social), then we have failed to do our best to get to the truth. And that means that we have also ignored opportunities to increase women’s safety and equality between the sexes.”

This does sound like using biology and science to push feminist ideas, again similar to Bad Men, but Carole Hooven is right to recognise the importance of biology. She returns to the scepticism of the media towards the effects of T described in Chapter 1:

“The popular press is full of attempts to bring King T down, to show that he is too big for his boots, or more generally to dismiss biological accounts of psychological and behavioral differences the sexes.”

The author describes what she believes are the reasons for this resistance in accepting T’s effects:

“It appears to have its source in three main worries. First, people think that the T view suggests that testosterone is destiny. Second, they think it suggests that male behavior is natural, and thus good or acceptable. And third, they think it suggests men aren’t to blame – their T gets them off the hook.”

Off the hook for what? – you might ask. Sexual assault is one example possibly. The case of Chanel Miller, who was involved in a sexual assault case against Brock Turner, is described here. This case was also mentioned in Bad Men. Miller and Turner were students at Stanford University and Turner was found lying on Chanel Miller on campus around 01:00am by two Swedish students. Turner subsequently tried to run away but was apprehended by the students. Turner was sentenced to 6 months in jail which was considered a miscarriage of justice.

In 2019 Ms Miller, who was known during the case as “Emily Doe”, revealed her identity by publishing the memoir Know My Name. Carole Hooven is sympathetic towards Chanel Miller but the incident between Ms. Miller and Brock Turner appear to be more complicated. I recommend the reader look at these blog posts exploring the case, which was critical of the simplistic narrative put forward by the media. Bob Somerby, who wrote the posts, notes:

“At trial, Turner testified that he and Miller left the frat party together, and that Miller consented to engage in sexual behavior once they got outside. Did Miller voice some such consent? We have no way of knowing, but then again, neither does Miller! By her own account, she doesn’t remember anything she said and did after roughly midnight that night, and the assault occurred a roughly 1 AM.”

The Daily Howler – The Age of the Novel

This post also makes a compelling point:

“In these cases, we’ve moved beyond the already difficult “he said/she said” dynamic to a different state of affairs, in which “he says/she can’t remember.”

The Daily Howler

In short, Miller’s version of events is open to scrutiny given that she was too drunk to remember what was happening which is likely why Brock Turner initially got a light sentence.

Similarly, Dr. Hooven is sympathetic towards the #MeToo movement:

“Testosterone tends to promote high libido and the acquisition of mates, and if a man’s power, a culture’s failures, or a victim’s powerlessness can do the trick, that will be the road taken by some. But we can also put roadblocks in the way. #MeToo is a movement that has made real progress, and hopefully that will continue.”

I’m less enthusiastic about the movement since it is basically the usual ‘female victims, male perpetrators’ narrative but I won’t hold that against the author since support for #MeToo is the mainstream opinion. Also, Carole Hooven does point out in the notes at the end of the book that there may have been some overreach with #MeToo.

The chapter continues with describing the reluctance that some have in accepting the effects of T due to its contribution to “undesirable male behavior” and possibly leading to the conclusion that “there’s nothing that can be done to curb men’s excesses.”

The author argues that being upset about facts does not change them, reflecting that she was upset upon learning her father had cancer but she could not change the fact that he did. This is a good point, but the argument still comes across as ‘men are a problem, and here’s the science to prove it.’

Here’s some similar quotes from the book:

“Some may worry that if people believe that T is responsible for reprehensible male behavior, then it provides men with a free get-out-of-jail card.”

Sort of like women and feminism perhaps? Dr. Hooven also asks:

“What’s the appropriate response to the fact that men do the majority of raping and assaulting, not to mention hoarding the world’s power?”

The idea of men “hoarding the world’s power” is similarly indicative of feminist thinking. Nevertheless, Dr. Hooven balances all of this slightly by acknowledging that men are more likely than women to perform heroic acts as well.

Some of Carole Hooven’s viewpoints were likely influenced by what she reveals in this final chapter: she was once a victim of rape.

She does not elaborate on the details of the incident (not that she has to) but explains that some of her distress at hearing Randy Thornhill’s theory of rape as an adaptation was influenced by her own experience years before. This also influenced her desire to study testosterone:

“It’s only through writing about men and testosterone that I have come to appreciate that my driving desire to learn about testosterone and how it works might have something to do with my own difficult experiences with men. But it hasn’t been all bad: while some men have wounded me, far more have supported, mentored, and encouraged me.”

Overall, I think Carole Hooven is a ‘good egg’ and has intelligence which she’s put to good use. I can also understand why she would be influenced by feminist ideas even though I don’t agree with them.

Summary: I definitely learnt a lot about testosterone from reading this book so I can recommend it for that reason. Carole Hooven does a good job of presenting a lot of scientific information in a clear and interesting way with the help of Felix Byrne’s hand-drawn illustrations. Reading this book alongside The Ape That Understood the Universe should give you a good understanding of sex differences and biology, whether or not you completely agree with the authors.

Thank you for taking the time to read this review.

Book Review: ‘Testosterone: The Story of the Hormone that Dominates and Divides Us’ by Carole Hooven (Part 2)

Chapter 5: T and Performance in Sport

The fifth chapter of this book explores the role of T in physical activity and how this leads to differences in male and female performances. The issue of men who have transitioned and compete in women’s sports is a notable and ongoing controversy since men have a natural physical advantage over women.

This issue is not restricted to trans-women though. The South African athlete Caster Semenya had to undergo testing to determine her sex after other runners complained about her dominance in athletics, which included winning the 800m Gold at the 2009 World Championship as well as in the 2012 and 2016 Olympics. Pierre Weiss, the General Secretary of the International Association of Athletics Federations (IAAF) – now known as ‘World Athletics’ – clumsily remarked Semenya “is a woman, but maybe not 100 per cent.” Possibly to counter claims she was a man, Caster Semenya appeared in the South African magazine You wearing make-up and a dress to appear more feminine. This can be seen below.

Semenya has high levels of T because she has a difference of sex development (DSD) condition. This elevated T is why she had been so successful in athletics as this gives her an advantage over other female athletes.

In 2018, the IAAF introduced new regulations to deal with DSD-affected athletes like Caster Semenya. In order to compete in women’s sports, such athletes have to take drugs to lower their T levels or otherwise be banned from competing. Semenya has refused to lower her T levels, believing that the regulations were brought in to target her, and so is not allowed to compete in certain events.

As evident in previous chapters, some people refuse to believe that T creates such distinctions between men and women, or women and intersex people. A transgender activist called Veronica Ivy (who changed her name from Rachel McKinnon for some reason), has argued that the relationship between T and sports performance is flawed. Ivy was born a man but transitioned to a woman and went on to compete in cycling and become a World Champion. Do you think she may have some ulterior motive here?

Other sports stars are more honest. The former tennis champion John McEnroe commented that while Serena Williams is the best female tennis player in the world, “if she played in the men’s circuit she’d be like 700 in the world.” Despite the subsequent controversy over McEnroe’s comments, Serena Williams admitted that she would lose to male tennis players.

To show why T gives men an advantage over women in sports, Carole Hooven presents the fictional boy-girl twins Samuel and Sofia as an example. Sam and Sofia compete against each other in sports but after puberty Sam always has the advantage over his sister.

This is the same for men and women in general. According to Carole Hooven, in 2019, 2500 men beat the fastest women’s time in the 100m event and women’s world records are around 10% lower than men’s. This is why men and women rarely compete together:

“Without segregation, it’s not just that men would win – women would never even qualify for the competitions in the first place.”

Veronica Ivy, however, has argued that the performance gap between men and women is closing. Carole Hooven states that this is incorrect. There are others like Veronica Ivy who are just as stubborn against the facts. A psychologist called Beth Jones appeared on the BBC Radio 4 show Woman’s Hour (a very feminist-friendly programme) to discuss transgender athletes and argued that women could improve by competing against men!

Similarly, Rebecca Jordan-Young and Katrina Karkazis, mentioned in Chapter 1, have argued that T is not an indicator of performance as athletes with the highest T levels do not always win competitions. The author counters by pointing out that this is within athletes of the same sex rather than between men and women so this is a “bait and switch” tactic by Jordan-Young and Karkazis.

Nevertheless, it is true that T levels vary between individuals and even then are not static. We have higher T in the morning than at night and T levels decline as we age. Physical activity will also reduce T levels for a period. Levels of T are often measured from extracts of blood or saliva but this is not without complications. Most of our T is bound to carrier proteins and only 2% is unbound or “free” so the levels of T measured may include both kinds. Additionally, measuring levels in women is more difficult than in men because other androgens in women may increase T level detection.

Again, there is scepticism about T in this domain. Sari van Anders, from Queen’s University, Canada, claimed that men and women’s T levels overlap and the binary is purely political. It won’t come as a shock to learn that Sari van Anders is involved in transgender activism. Ms. van Anders’ argument is contradicted by studies of T levels detected using mass spectrometry (MS), what Dr. Hooven calls the “gold standard” of T measurement. The endocrinologist David Handelsman did a meta-analysis of studies of T measured using MS and found that there was no overlap in T levels between men and women. This is shown in the book by the graph drawing below:

This is in contrast with height differences between the sexes where there is overlap. These studies only measured healthy men and women however. Would the distribution of T levels be different if, say, DSD conditions were included? A study by Richard Clark measured T levels including those with DSD conditions like CAH and 5-ARD which have been described previously. Conditions like CAH and polycystic ovarian syndrome (PCOS) lead to increased androgen production so will have some effect on T levels. However, even this does not cause overlap between men and women as seen below:

The author returns to her hypothetical twins Sam and Sofia to discuss how they would have developed in the womb and then in adolescence. Chapter 4 explained how males are exposed to T in the womb years before boys experience an increase in T during puberty. There is also an increase in T shortly after male babies are born which has been called a “mini-puberty” although the reason behind this is not well understood. Puberty is of course where boys and girls start to diverge more clearly. This is initiated by the hypothalamus in the brain.

The hypothalamus releases gonadotropin-releasing hormone (GnRH) which triggers the pituitary, also in the brain, to release lutenising hormone (LH) and follicle-stimulating hormone (FSH) into the bloodstream. LH and FSH would stimulate the release of hormones from Sam’s testes and Sofia’s ovaries respectively. The T released in Sam’s body leads to changes such as increased muscle growth, increased bone growth and heightened haemoglobin levels. In contrast, Sofia would experience more fat generation than muscle. This inevitably has an effect on how well the twins would perform at sports. After puberty, Sam would be able to outcompete Sofia easily.

Carole Hooven also explains that women with PCOS, which increases T, were found in one study to be over-represented in elite sport. 37% of Swedish female Olympians had PCOS which is three times the population rate. The mainstream media also regularly reports DSD women athletes as having “naturally high T levels” without mentioning their DSD condition, which may mean the athletes have XY chromosomes and male genitals! Complicating matters is the fact that the benefits of T, like muscle and bone size, would remain even if athletes like Caster Semenya were to take drugs to lower their levels. The author writes that she is unsure how to resolve the problem of DSD and transgender athletes since neither side of the argument will be completely satisfied. But, Caster Semenya and others like her should be treated with respect.

Chapter 6: T and Mating

Years after her trip to Uganda to observe chimpanzees, Carole Hooven visited the Scottish island of Rum to observe its abundant red deer population.

During mating season, called the “rut”, male stags will compete against each other to mate with females, called hinds, which the stags guard in harems. A few stags will have harems of hinds whilst other stags will have none.

One stag, named by the researchers there as “Wisdom 11” – the name of its mother, Wisdom, and the year it was born, 2011 – was particularly successful in mating. This was because Wisdom 11 was big, strong and healthy which meant he could challenge other stags and dominate territory.

However, other stags without harems may attempt to mate with hinds behind a successful stag’s back, earning the less successful stags the name “sneaky fuckers.”

Another stag, named Tattler 06 (mother Tattler, born in 2006), challenged Wisdom 11 by approaching and responding to Wisdom 11’s roars by roaring back. Other stags may have backed off when met with roars. At this point, the two males did not engage in fighting:

“Like most people, red deer stags don’t make a habit of recklessly jumping into a physical conflict. Fighting is risky and draining and is best reserved for when the rewards – usually hinds or increased dominance that might help to get hinds later – are worth the risk.”

In short, stags prefer to intimidate rivals by roaring instead of engaging in combat with them which could be harmful. Roaring is also an indication of dominant stags’ size, strength and therefore fighting ability. A rival who roars back to challenge a dominant male may eventually back off, but Tattler 06 remained. This ramped up the challenge. Both Tattler 06 and Wisdom 11 moved towards each other and battled with their antlers. If one stag can force the other to the ground, the stronger stag will force its antler tip into the weaker stag’s flank to injure it. Afterwards, the fight starts again. The author writes:

“It all struck me as rather gentlemanly. No cheating, no funny stuff. They were following all the rituals on the road to battle I’d read and taught about for many years.”

Wisdom 11 ultimately won the challenge as Tattler 06 eventually backed off. Carole Hooven witnessed similar skirmishes during her short stay on the island. Wisdom 11 even challenged another harem holder called Glariola 09 and ended up winning and taking Glariola 09’s four hinds!

Similar to the chimpanzee Imoso in Chapter 1, stags may attack hinds who stray or are unresponsive to mating. Hinds are less aggressive than stags because, as Carole Hooven puts it, they are not competing for a “reproductive jackpot.” Compared to dominant males, females will not produce as many calves so there is minimal competition between hinds.

Outside of mating season, male red deer do not compete for females and the sexes live separately. Stags’ testes “shut down” leading to a drop in T levels and their antlers fall off. The author calls this a “temporary castration.” Antlers start to grow again after the old ones have fallen off but are covered in a velvet-like coating to supply blood to the new ones. When mating season comes round again in the autumn, T levels increase resulting in changes in the body once again. As with other animals, T exposure in the womb works on stags to allow for changes later in puberty. Similarly, during mating season, increase in T allows for changes to occur in stag bodies without any complications.

Increase in T affects stags in the following ways:

  • The “antler velvet” that supplies blood for regrowth is shed to reveal the new antlers.
  • Increased calcification of bone which makes stags stronger, particularly the antlers.
  • Increased muscles around the neck which are used for fighting.
  • Increased shaggy mane around the neck to make the stags more intimidating.
  • Increased red blood cell production which increases oxygen transport and stamina.

Like what has been described in earlier chapters, Carole Hooven presents experiments that have been carried out on the Rum stags to discover the effects of T. In one experiment in the 1970s, stags were castrated at different times of the year – in and out of mating season – to see what effect this would have. Castrated stags lost their antlers and the regrown antlers remained covered in velvet and weak. Essentially, the body changes listed above that follow T increase were absent – no extra neck muscle, no shaggy mane, etc.

The absent T was then replaced in the stags using slow release capsules during mating season and outside of it to see if this had any effect. The stags returned to normal mating behaviour when hinds were fertile but did not show “rutting behaviour” outside of it. The author suggests other “cues” need to be present for the stags to engage in a rut such as seasonal changes. However, outside of mating season, stags with elevated T will still fight with other stags to display dominance.

A key motivator for stags fighting for dominance, like with other males, is to gain access to females. Females prefer to mate with dominant males over weaker ones. This is the underlying theory of ‘sexual selection’ which can be divided into male-male competition and female mate choice.

The author writes:

“The quintessence of this kind of sexual selection by “mate choice” is the peacock, with his train of long, brilliantly colored and decorated feathers. The peahen’s backside, by contrast, looks stunted and dull.”

Charles Darwin theorised that the ornamentation of male birds like the peacock is a result of female mate choice in his book The Descent of Man, and Selection in Relation to Sex.

“When females actively choose certain males for mates, whether it be the beautiful, bold, melodious, mean, or fragrant, her “decisions” are likely to be forceful drivers of the evolution of his secondary sex characteristics”

If you’ve read my review of The Ape That Understood the Universe, you might have seen my mention of an alternative theory that raises questions about this theory of sexual selection in peacocks. Although it’s nearly a year since I wrote that review, I’m still planning on writing about this alternative theory and hopefully posting it very soon.

Aggression and dominance are not restricted to males, however. Females of other species who fight each other for dominance include naked mole rats, spotted hyenas and meerkats. For the most part though, females tend to be less aggressive than males as there is usually less benefit for them.

This chapter also describes other animals that have similar breeding seasons to the stags on Rum. Arizona spiny lizards also have a breeding season in the autumn but male T regulation is not as up and down as that of stags. Just after mating season has ended during winter and spring, the lizards have low T levels but this increases during summer before the new mating season.

Male lizards will begin showing displays of dominance towards other males such as bobbing their heads in the summer before females come along in the autumn. Carole Hooven writes that T is at the “Goldilocks level” – in other words, is “just right” before autumn when T levels will increase. Why do these lizards have an intermediary period of T levels between mating seasons? Wouldn’t having high T levels be advantageous, even in the summer?

Again, experiments have been carried on these lizards to observe the effects of T on behaviour. Predictably, castrated lizards show no interest in females and are not aggressive or territorial. In contrast, lizards given T during the summer increase their territorial and dominance displays. While this would suggest the high T lizards would have the upper hand going into mating season at the end of summer, apparently 50% of the high-T lizards had died by this point compared to 20% of the ordinary lizards. The high-T lizards “came out of the gate too fast” – i.e. used up a lot of their energy guarding and patrolling their territories which made them vulnerable. Conversely, normal lizards saved their energy for the autumn and spent time resting and eating instead.

Male birds go through similar cycles of T but their mating behaviour is slightly different. John Wingfield, an evolutionary biologist who has studied birds (Carole Hooven notes his name is appropriate) found that song sparrows in the US have fluctuating T levels depending on if they are competing for females or providing for females and their chicks.

Like many species of bird, song sparrows will pair up for a season to look after their offspring and the males’ T levels will drop during this period. Males who were given an increase in T spent more time guarding territory and competing for new females instead of looking after chicks. Like with the spiny lizards, having “Goldilocks level” T is important for mating.

Elevated T does have its uses in this scenario however. Caged male birds placed in a wild bird’s territory will cause the wild male to confront and attack the caged bird who it perceives as a threat. As expected, the wild male bird’s T levels go up when responding to an intruding male. This has been called the “challenge hypothesis.” This response enables the males to protect their territory and their ‘family’:

“In short, T levels fluctuate depending on whether a male needs to be ready to breed, care for his family, or fight off rivals.”

Chapter 7: T and Violence

Chapters 2 to 6 are very solid in terms of scientific information and insight highlighting Carole Hooven’s qualities as an academic. The final four chapters (8 to 10 will be covered in Part 3) explore in more detail the role of T in explaining human behaviour.

It is at this point that the book dips a little bit in quality in my opinion as we get into more social commentary. That doesn’t mean these remaining chapters are not worth reading though.

The aggressive, dominant and territorial behaviour that is evident in male animals when T is increased has obvious parallels with human behaviour and particularly male violence. The chapter starts by describing an incident that happened to the writer Daemon Fairless, author of the book Mad Blood Stirring: The Inner Lives of Violent Men. During one New Year’s Eve in the subway of Fairless’ home city Toronto, a drunken young man was attempting to open the train doors which resulted in Fairless confronting him. The confrontation escalated into the two men getting into a fight. Carole Hooven notes that this incident would rarely play out between two women.

This inevitably leads to exploring “toxic masculinity.” The anthropology professor Matthew Gutmann has studied masculinity for many years and wrote the book Are Men Animals? How Modern Masculinity Sells Men Short where he argues that male violence and aggression can be largely explained by socialisation rather than biology. According to Carole Hooven, Professor Gutmann believes there is “little relationship with T and aggression.” In this way, his argument is similar to modern perceptions of sex differences being a product of nurture rather than nature. Moreover, the American Psychological Association has put forward the idea that male aggression is a production of “gender role socialisation” which is aimed at upholding “patriarchal codes” by requiring men to act dominantly.

Carole Hooven, of course, believes that these assumptions are incorrect and, in fact, T and biology do play a role in male violence. As shown in Chapter 6, one reason for aggression in males is to compete for females. Nevertheless, Dr. Hooven concedes that not only men can commit acts of violence:

“it would be a mistake to think of women as incapable of promoting – and sometimes of carrying out – extreme acts of violence. In 1994, during… genocide in…Rwanda…Pauline Nyiramasuhuko was the minister for Family Welfare and the Advancement of Women. She was later convicted of charges of genocidal rape. One witness recounted that right after Nyiramasuhuko ordered militia members to burn seventy women and girls using gasoline she had in her car, she said, “Why don’t you rape them before you kill them?””

Intimate partner violence (IPV) statistics also present conflicting and controversial facts about the prevalence of violence between men and women. Helen Gavin and Theresa Porter report in their book Female Aggression that wives are more often perpetrators of physical assault in relationships than men according to a study from Detroit. Similar results have been found in cities like London, Budapest and Stuttgart.

Here Carole Hooven reveals a weak spot in her thinking, in my view at least, and we get to one of the low points of this book. While I would broadly agree with Helen Gavin and Theresa Porter’s findings, Carole Hooven instead responds:

“When I first learned of this evidence, I was skeptical. It ran contrary to everything that I thought I’d learned about domestic abuse, and it was hard to imagine women as significant perpetrators.”

Dr. Hooven goes on to say that because women are generally physically weaker than men, they are less likely to inflict damage than men are on women. This is important to consider when discussing IPV, but the point is whether its prevalence is heavily skewed in one sex or the other, notwithstanding if men can inflict more damage than women.

The author also describes how empathy may play a role. Below is my least favourite passage from this book, and probably where I would disagree with Carole Hooven the most:

“Empathy is our ability to understand how others are feeling, and men are less able to do this than women, across cultures. This is a widely replicated and consistent finding, and it’s not true just of human males and females. In chimpanzees, bonobos, gorillas, elephants, dogs, and wolves, researchers have observed that males engage in lower rates of behavior related to empathy, like caregiving, cooperating, helping, and comforting.”

Carole Hooven might as well be saying here that “women are just better people!” although I don’t think she actually believes that. The point that females tends to do more caregiving and comforting is true, but this to me is like saying that extroverts are more empathic than introverts since extraverts prefer to be socialise and be around people whilst introverts may prefer to spent time by themselves. As far as I can tell, reports of empathy seem to rely on self-assessments and so could be considered subjective.

A few months ago, I retweeted this comment on one of Jordan Peterson’s tweets. The commenter noted that the word ’empathy’ didn’t exist until the early 20th Century and thus psychological study was biased towards a concept that humans beforehand had not even given a word to. It would take me too long to explore this further here, but I think ’empathy’ is often used to put forward the ‘women good, men bad’ viewpoint. Even when empathy is considered to be a flaw, the reasoning follows what I would call the ‘women are too nice for their own good argument.’

Dr. Hooven even suggests that violent men’s “reduced empathy” makes male-perpetrated IPV worse than female IPV. By this logic presumably, when a woman attacks her husband or boyfriend, it’s from a place of empathy and compassion, unlike that of nasty men.

Carole Hooven also mentions Margo Wilson and Martin Daly’s theory that most female violence is self-defence which I discuss a little bit in my review of Bad Men. Let’s just say I’m wary of that idea as well. I may have my own bias in rejecting these arguments, but they still strike me as simply “mental gymnastics” to explain away any understanding of IPV that doesn’t fit the ‘female victims, male perpetrators’ narrative.

Overall I found this part of the book disappointing. I realise that Carole Hooven is a public figure and I’m not, and that she’s a biologist rather than a psychologist, so we can be somewhat lenient towards her stance here since she’s likely relying on conventional wisdom. I don’t expect her to align 100 percent with my own views either. Furthermore, none of this takes away from what she has written before or her merits as a teacher.

With that out of the way, I’ll return to the book.

The author does point out women and girls are not necessarily less aggressive than men, but are instead more likely to engage in indirect aggression. Aggression itself can be divided into two categories: “reactive aggression” and “proactive aggression.”

Reactive aggression is instantaneous and often a response to triggers that make someone angry or threatened. It is more common between two individuals. Proactive aggression is more calculated such as planning an attack. It is more common in groups or institutions such as the military. The book claims that neither sex has a monopoly on either kind. The relationship with T and reactive aggression is clearer than T and proactive aggression and is the main focus of this chapter.

Measuring aggression can be difficult but one option is to study violent crime statistics since these are more likely to be recorded. As mentioned in Chapter 1, men are more likely to commit violent crime than women. Most murders, for example, are male-on-male. Other evidence includes studying male skeletons unearthed by archeologists which are more likely to show death by violent conflict. The author writes:

“The more risky, extreme, and cruel the violence, the larger the sex difference, and the greater the proportion of male offenders.”

Physical aggression by men is more beneficial than it is for women, as shown in Chapter 6. Adaptations for aggression in males is evident in the fact that men are generally bigger and stronger than women, take more physical risks and engage in more rough and tumble play in childhood.

Aggression and violence are correlated with T so rising and falling levels will have an effect. There are two situations where T levels in males are particularly sensitive: those relating to sex and those relating to violence or threat.

Humans and one of our closest relatives, chimpanzees, are not seasonal breeders like the animals described in the previous chapter. This means that the testes, in Carole Hooven’s words, “are always on the go.” The T levels of males in many species are usually highest when females are fertile. In female chimps, fertility is ‘advertised’ by “sexual swelling” of their backsides. For humans, however, this is different as women’s ovulation is concealed. The author suggests this is one reason men stick around even when women are not pregnant although also notes that children are more likely to survive if fathers are around as well. T levels in men will alternate depending on if they are trying to attract a woman (high) or if they are in a relationship and have children (low or at least lower).

Violence is usually a last resort tactic in animals because of the costs that go along with it, reflecting the confrontation between the two stags described in Chapter 6. The threat of violence allows stable hierarchies to form within groups, such as in primates, with the dominant primates being able to assume power over weaker ones. Similarly, men in smaller societies such as hunter-gatherer types would know their place within a hierarchy based on similar kinds of dominance. The more successful men will rise though the hierarchy based on their abilities as a hunter. The book notes that T levels are not only determined by biology, but are also situational. For example, in response to danger, a man might become bold and face it or afraid and flee – i.e. the ‘fight or flight’ response. The divergent reactions are related to T as an increase will usually result in the more bolder response. Alternatively, fleeing may result in a drop in T.

Biological differences may explain how T changes result in differing responses between individual men. The androgen receptor, which T binds to, is more effective in some men than others. This likely explains why some men, for instance, can grow beards easier than others and are stronger and more aggressive. Studies have found that the DNA sequence in the androgen receptor gene has a repeat of C-A-G bases or “CAG repeats.”

If you are not familiar with DNA bases, there are four types, called adenine, cytosine, guanine and thymine or A, C, G, T (not to be confused with testosterone). Adenine joins to thymine and cytosine to guanine to form the DNA double helix. A DNA sequence consists of the four bases so a “CAG repeat” may look like this:

CAGCAGCAGCAGCAGCAGCAG…

These bases would join together with a sequence that looked like this:

GTCGTCGTCGTCGTCGTCGTC…

Hopefully that will make the following clearer.

Having fewer CAG repeats in the androgen receptor gene means that the receptor will be more effective and therefore show a greater response to T. This has downsides however as fewer CAG repeats is linked to a higher probability of getting prostate cancer and “spontaneous abortions” in pregnant women. Men with short CAG repeats are said to get more pleasure out of being aggressive. T release is also linked to the release of dopamine which influences motivation and reward.

According to Dr. Hooven, T reduces empathy since motivation and reward are increased and fear and the perception of pain are decreased. Despite my reservations about the author’s earlier claims about empathy, I have to concede here that there may be something to this. It makes sense that violence and risk-taking require detachment to some degree in order to focus on the violence/risk being undertaken. On the other hand, we could debate whether ‘detachment’ and ‘decreased empathy’ are the same thing. I still think empathy is a vague term that should be debated.

Nevertheless, T does not always stimulate excessive violence. The endocrinologist Robert Sapolsky has studied aggression in animals such as talapoin monkeys in his book The Trouble with Testosterone. A study in which talapoins were given an increase in T led to more aggressive behaviour but this was directed towards other talapoins below them in the monkeys’ dominance hierarchy rather than a violent free-for-all. Thus, T could be said to work as a ‘performance enhancer’. Carole Hooven explains:

“T is not a potion that turns the meek into warriors or that causes rampant bellicosity. Its effects depend heavily on individual and environmental factors, and in humans especially, winning and achieving high status can often be accomplished without any physical aggression at all. T tends to do what the situation requires.”

The male body must therefore be able to undergo “rapid T changes” in order to react to an unpredictable situation. According to Carole Hooven, it is not known at present how the body can respond so quickly to these rapid changes since it takes time for T to bind to a receptor then move into a cell nucleus to stimulate gene transcription. One possible explanation is that T acts like a neurotransmitter and interacts with the cell surface as well.

The author concludes this chapter by pointing out that culture has an effect on the prevalence of violence. In Singapore, for example, there are very strict laws which has resulted in a low crime and murder rate. Carole Hooven writes:

“Frank talk about T will help us appreciate how changes in the environment can rein in problematic male behavior.”

Is it only men who are the problem though? It’s one thing to accept that men commit most crimes and violence, but we shouldn’t assume that women are either innocent victims or simply bystanders because of this. Since male violence may result in an increase in status, power and resources, why should we think that women would have nothing to do with it? The idea that anything that is male-dominated will only benefit men is what I call the “by men, for men fallacy” which I might write about at some point.

Here are some other interesting facts from this chapter:

  • Personality likely affects how men may react to a threat to their status and reputation. “Dominance-oriented” men who are also impulsive are more likely to respond to increased T with aggression.
  • Rapid T level changes have been observed in sport as levels will fluctuate in response to a win or loss. During the 1994 FIFA World Cup final (Italy vs. Brazil), which was held in the US, researchers from Georgia State University collected saliva from Italian and Brazilian football fans before and after the match to measure T. Following the match, the T levels from the Brazil fans stayed the same or increased whereas the levels in the Italy fans declined. This was because Italy lost and Brazil won.
  • Similar effects to winning and losing have been tested in women. However, there is scant evidence that T mediates female competitiveness. It is possible though that other hormones may be involved instead.

This review will be concluded in Part 3.

Book Review: ‘Testosterone: The Story of the Hormone that Dominates and Divides Us’ by Carole Hooven (Part 1)

(4/5 stars)

Overview: An informative exploration of the role testosterone plays in sex differences and biology. The book is strongest when it is centred on the science and weakest when Carole Hooven expresses her personal and political views. Fortunately, the former makes up most of this book.

Testosterone is the third and final book of an unintended trilogy I’ve read recently which could be called ‘The Science of Sex Differences’. The other two books in this ‘trilogy’ are the ones I’ve reviewed on this blog: Bad Men by David Buss and The Ape That Understood the Universe by Steve Stewart-Williams.

Like Bad Men, I wasn’t planning on reading and reviewing Testosterone but I was interested after seeing it mentioned in discussions on sex differences on Twitter. Steve Stewart-Williams also praised the book and, since I mostly enjoyed his own work, I thought Testosterone was worth looking into.

Carole Hooven is a lecturer in the Department of Human Evolutionary Biology at Harvard University which is also where she studied her PhD in sex differences and testosterone.

Chapter 1: The Controversy Surrounding Testosterone

In 1999, Carole Hooven spent 8 months studying chimpanzees in the Kibale forest in Uganda after applying for a program run by primatologist Richard Wrangham, whose work fascinated her. In January of that year, she witnessed an incident that would become the subject of an article in Time magazine a few years later. A male chimp, named “Imoso”, who was the “mayor” of a “town” called Kanyawara, attacked a female named “Outamba” with a large stick. Carole Hooven told Richard Wrangham what had happened and was told that she was the first researcher to observe a wild animal using a tool as a weapon against its own species. The stick was later recovered by field assistants and Dr. Hooven saw it again in 2002 as explored in the Time article ‘The Wife Beaters of Kibale.’ I managed to find the actual article which can be seen below and you can read the article here.

Dr. Hooven noted the contrasting behaviour between the male and female chimps: the female chimps were relatively peaceful whereas the male chimps were more aggressive and obsessed with hierarchy. While male chimps are not violent all of the time, they will use violence for several purposes, such as to show dominance, fight over a sexual opportunity or to make a female more sexually compliant in future. This last example may have been the reason that Imoso attacked Outamba.

From this and other experiences, the author “longed the understand men” and began work on her PhD on testosterone.

According to Dr. Hooven:

“Testosterone is present in our blood in minute quantities. Both sexes produce it but men have ten to twenty times as much as women.”

Testosterone in an androgen hormone, with ‘andro’ meaning “man” and ‘gen’ meaning “generating.” Possibly to avoid the writing becoming cumbersome, the book commonly refers to testosterone as “T” which I will do as well. Although both sexes have T, we commonly associate it with men than we do with women. Dr. Hooven notes:

“If the Y chromosome is the essence of maleness, then T is the essence of masculinity, at least in the popular mind.”

The association with T and masculinity is reflected in political debates, such as the contrasting perceptions towards Donald Trump. Commentators on the political Left believed Trump had too much T whereas those on the political Right thought that mainstream conservatives who opposed Trump had the opposite problem:

“According to the left-wing Huffington Post, Trump’s presidency is “testosterone-fueled”, making it “an extremely dangerous one” that could lead to war. According to the right-wing American Spectator, the problem is not too much T, but too little, among some prominent conservatives.”

It’s interesting that Joe Biden’s left-wing and presumably less “testosterone-fueled” presidency has coincided with the disastrous withdrawal of troops from Afghanistan and Russia invading Ukraine, both of which make the world a more dangerous place.

From a biological perspective, the role of T is thought to help increase male’s reproductive output by affecting anatomy, physiology, behaviour and energy which is directed towards competing for mates. T also plays an important role in aggression, which can be seen in the difference in violence and crime rates between men and women. The author writes that men are:

“responsible for around 70 percent of all traffic fatalities and 98 percent of mass shootings in the United States, and worldwide commit over 95 percent of homicides and the overwhelming majority of violent acts of every kind, including sexual assault.”

Like I wrote in my review of The Ape That Understood the Universe, which also describes this difference between the sexes, I believe women’s relationship with crime and violence is more complicated than we like to think, but I’ll go into more detail about this later on in this review.

As the reader is no doubt aware, talking about sex differences and the effects of T can be controversial. Some academics and researchers have expressed scepticism towards some of the findings about T. For example, Rebecca Jordan-Young, a ‘gender studies’ scholar, and Katrina Karkazis, an anthropologist, wrote a book called Testosterone: An Unauthorized Biography, in which they attempt to debunk, in their minds, some of the claims made about T.

Carole Hooven also describes another controversial idea that is debated in academia, the evolution of sexual behaviours like rape. Randy Thornhill put forward a theory suggesting that males across many species will rape females if they are unable to provide resources and may be one reason why males tend to be larger than females in humans. Dr. Thornhill and his theory will be familiar to anyone who has read Part 3 of my review of David Buss’ book Bad Men. Dr. Hooven admits to being “triggered” when she first heard about Randy Thornhill’s theory as an undergraduate. At the time, she called him an “asshole” but was told by her professor to respond to the data and argument without getting emotional:

“It wasn’t an easy process. My emotions didn’t evaporate. And I’m still not thrilled with what strikes me as tone-deaf writing about a sensitive topic. But I learned that I could evaluate the evidence for an upsetting hypothesis on its merits; that by itself was empowering.”

This quote illustrates that Carole Hooven is an academic who believes in objective truth and knows what they are supposed to do when debating controversial ideas: to try and look at the facts without emotions and personal feelings from interfering too much. She did, in fact, later meet Randy Thornhill and said he seemed like a nice guy.

Dr. Hooven has incorporated into her course other individuals who have had caused controversy from talking about sex differences. In 2006, Lawrence Summers ended up resigning from his position as President of Harvard following a speech he gave where he suggested that women’s underrepresentation in science courses was partly due to “intrinsic aptitude, and particularly of the variability of aptitude” between the sexes. A decade later, James Damore lost his job at Google for suggesting that sex differences in preferences are one explanation for the lack of gender parity at the company and their aim to achieve parity was “misguided.” During both of these controversies, Dr. Hooven realised she was “on the wrong side of the divide” for embracing the scientific information behind both men’s claims.

Here Carole Hooven also explores the “feminist backlash” towards claims of sex differences and expresses some sympathy towards this sentiment:

“the fact is that women have good reason to be suspicious of “biological” explanations of sex differences. Scientists and philosophers – mostly men – have a history of confidently expounding on the alleged biological basis of women’s inferiority.”

While I admire Dr. Hooven’s commitment to objective truth and scientific inquiry, this quote seems, to me, to be an example of ‘feminist thinking’ affecting the author’s viewpoint. Why should we assume that whatever male scientists and philosophers wrote about women in the past was simply chauvinism and ignorance? We can certainly debate about particular claims men may have historically made about women, but it is important to understand the context behind those claims as well.

Similarly, the book presents Charles Darwin’s claim about “man’s attaining to a higher eminence, in whatever he takes up, than can woman – whether requiring deep thought, reason, or imagination, or merely the use of the senses and hands.” This can obviously sound offensive to our modern sensibilities, but the observation is accurate in the sense that men are more likely than women to be over-represented in exceptional achievements and endeavours. Of course, it can also be said that men are over-represented in many unfavourable ways as well.

In response to Darwin’s claim, Dr. Hooven writes:

“From our more enlightened perspective, we can create an obvious alternative hypothesis: women are simply being held back by constraints imposed primarily by society rather than by their naturally inferior mental capacity.”

Carole Hooven could be accused here of doing the same thing as those who opposed Lawrence Summers and James Damore: rejecting a claim about sex differences on the basis that she personally dislikes and disagrees with it. I suppose I could be accused of doing this as well if you’ve read any of my previous posts where I have disagreed with an apparent sex difference. However, I try to acknowledge any bias on my part and explain what I disagree with and why. I don’t always share the author’s opinion on certain sex differences in this book either, which will come up later on in this review. The “more enlightened perspective” line is similar to people who claim to be “on the right side of history” or argue that certain words or ideas are unwelcome because “it’s [the current year].” Why should we assume that what we think is superior to what people thought in the past or assume that people in the future will agree with us?

Feminist opposition towards sex differences and how hormones like T may influence those differences is motivated in part by fears that these facts will be used to “uphold patriarchy.” Books such as Testosterone Rex by Cordelia Fine and The Gendered Brain by Gina Rippon which challenge findings about sex differences are motivated by this fear. Carole Hooven makes a good point here:

“In general, if you find a hypothesis distasteful, a red flag should immediately go up: there is a clear and present danger that you will discount the evidence that supports the hypothesis.”

Like David Buss in Bad Men, Carole Hooven believes that understanding the science behind behaviour, such as the effects of T, can help us to deal with the “darker parts” of human nature.

Chapter 2: A History of T: Experiments, Cultural Practices and Discovery

The second chapter in this book is my favourite as it covers two subjects I particularly like: history and biology. Specifically, this chapter explains how the effects of T were known for millennia before its discovery and isolation in the 20th Century. This was because humans could separate the primary source of T from the body of a male human or animal without killing them and then observe the changes that followed from this. To put it bluntly, cutting off the testicles rids the body of its main supply of T. Although humans weren’t aware of the hormone, or even the idea of hormones in general, they knew that performing this procedure had dramatic effects.

Aristotle, for example, observed that castrated male birds “cease to crow” and “forego sexual passion” following the procedure and birds castrated when young never develop these behaviours. Boys who were castrated before puberty never grew facial hair or experienced voice changes and male pattern baldness in adulthood. “What would be the point in castrating boys and men, other than as a cruel experiment?”, you may well ask. It was often done to punish enemies, rapists or prevent the mentally unfit from having children.

“Eunuchs” or castrated servants were often used to guard harems of women in civilisations such as Ancient Greece and Rome. In Imperial China, eunuchs not only guarded harems but also performed government operations and so could wield political power. Their position meant that they could be a source of gossip and advice. Eunuchs in this position seem similar to the character Varys in the Game of Thrones TV series and A Song of Ice and Fire books. Some men willingly became eunuchs despite the obvious disadvantages as it meant they could have comfort and possibly power although many were made eunuchs by force.

What follows is a description of how the Ancient Chinese performed the castration procedure which I’ll be generous and not relay to you here. As the reader might imagine, it was not pleasant and could result in agonising death. I never realised until reading this that the penis was also removed (see what I mean?) during the operation.

Whilst people could observe what happened when testicles were removed from males, advances in science led to people attempting to work out why doing this had such transformative effects. They likely knew that something in the testes was transmitted to the rest of the body, and that removing testes cut off this supply, but they did not know what the thing was, or whether it was transmitted through the nerves or the bloodstream. Like with many other scientific discoveries, it would take a series of independent experiments before scientists could determine that T works through blood rather than nerves.

In the 19th Century, Arnold Berthold performed an experiment in which he castrated some cockerels then reattached the testicles in the cockerels’ abdomens. In two of them, Berthold attached a testis from one bird into the other or a “foreign” testicle to observe any differences. He discovered that “masculinization” returned to the castrated cockerels upon reattachment then found after killing them and cutting them open that the testes had vascular connections to the colon. From this he concluded that whatever was in the testes acted via the bloodstream.

A little later, Charles Edouard Brown-Sequard theorised that diseases were caused by insufficient tissue secretions and injecting organisms with tissue extracts could treat various diseases. He pursued his theory by injecting himself with “crushed testicle extracts” of various animals and reported that he developed “mental clarity”, increased focus, strength, handgrip and stamina. Many other men repeated the procedure which became known as the “Brown-Sequard Elixir.” It is now thought that the effects were simply a placebo but it influenced further studies and contributed to the discovery of hormones.

This discovery emerged at the beginning of the 20th Century from the work of Ernest Starling and William Bayliss who operated on a dog to study its digestive system. Sodium bicarbonate is secreted from the pancreas during digestion to neutralise acids in the stomach and small intestine. The secretion is triggered by a hormone and the two men observed the secretion occurring in the blood. This led to the first isolation of a hormone, which they named secretin. Further research led to the discovery of more hormones such as oestrogen (of which there are three kinds) and testosterone a couple of decades later.

Here are some other interesting facts from this chapter:

  • In some animals, testicles remain inside the body like ovaries in females. This is the case for elephants, seals, whales, dolphins and frogs. Testicles are on the outside of the body in humans and other animals like dogs to keep sperm at a temperature ideal for sperm production which is lower than body temperature. It is not known why some male animals have internal testicles and some do not.
  • Castrated men can be tall and gangly despite lacking T. This is because T increases bone growth but also stops it. The growth spurt that may occur in such men is a product of “extended childhood growth.” Other effects of castration on males includes having smoother skin, increased fat and being physically weaker. Castrated cockerels or capons are created for this effect as they will have larger and more tender meat.
  • Ernest Starling coined the name for hormones – from the Greek ‘ormao’ – meaning to excite or arouse.
  • Testosterone is a steroid hormone, which are made from cholesterol. The receptors for T are inside the cell. Attaching to receptors allows T to influence physical and behavioural changes mainly relating to reproduction.

Chapter 3: The Effect of T on Developing Boys and Girls

In this chapter, Carole Hooven writes about a student of hers who has a difference of sex development (DSD) condition called “complete androgen insensitivity syndrome” (CAIS). The student, named Jenny (possibly a pseudonym to protect her identity) has XY chromosomes, T and has testicles instead of ovaries but appears, in the author’s words, “ultrafeminine.” How can this be?

Jenny has testicles but they are inside the abdomen where the ovaries would normally be. In addition, Jenny has female genitalia but no connection to the uterus. Throughout her life, she has had female primary and secondary sex characteristics. Jenny could thus be designated as “intersex” which in distinct from “transgender” which is explored in Chapter 9 of the book. Carole Hooven worked with Jenny as part of an independent study of her condition.

The reader may have worked out from the name of Jenny’s condition that her physical traits are a result of her body not being able to respond to the testosterone it was producing. Jenny’s case is useful to understand how boys and girls develop and differentiate when they are growing in the womb.

Carole Hooven explains how this happens using the analogy of baking cookies and hand-drawn diagrams such as below:

I do a little bit of drawing myself (observe the artistic masterpiece that is my Mystery Man logo!) so I thought these drawings were a nice touch and make the book stand out from other ones which may use standard diagrams and charts. Graphs shown in the book are also presented as drawings which I thought was a clever idea. Below is a graph from Chapter 1 showing differences in height between men and women:

If Carole Hooven had done the drawings herself (spoiler: she didn’t) I would have been tempted to give her book an even higher rating.

Like with baking cookies (or any food), humans require a certain set of ‘ingredients’ and ‘instructions’ in order to be healthily produced. Sex hormones stimulate the sex-specific traits we observe in men and women rather than sex chromosomes:

“Both sexes come genetically equipped to express all the traits typical of either sex. It’s just a matter of which genes are active, at which levels, in which bodies.”

Until week six of foetal development, boys and girls both possess “primordial” or “bipotential” gonads which then differentiate to become male or female. A protein called SRY, meaning “sex determining region of the Y chromosome” in males increases the transcription of certain genes on other chromosomes. If the reader is uninitiated in how gene transcription works, basically, DNA is unravelled and certain genes are ‘transcribed’ to make proteins:

SRY protein upregulates the production of another protein called SOX9 which helps turn the primordial gonad into testicular cells. Low levels of SRY and SOX9 will result in the development of ovaries instead of testicles even if the baby has XY chromosomes:

“XX and XY chromosomes are traits that are features of sex (in mammals), not ones that define sex.”

Here Dr. Hooven presents a hypothetical twin brother for Jenny she calls “James” to contrast how boys and girls develop differently during pregnancy and why Jenny possesses both male and female traits. In addition to the development of testes or ovaries from shared primordial gonads, both sexes have primordial duct systems that also diverge at around week eight. There are initially two sets of these ducts but, depending on the sex of the foetus, one set will degenerate and the other set will continue to develop. Boys will develop “Wolffian ducts” whilst girls will develop “Mullerian ducts” This diagram from the book may make this clearer:

The testes release Mullerian inhibiting hormone which causes the Mullerian ducts to degenerate which is what happened to Jenny. It is here that T also plays a role: the Wolffian ducts are stimulated to eventually form male genitalia. In the absence of T, the Wolffian ducts will degenerate:

“The female duct system is the default: it will develop without any specific hormonal stimulation, unlike the male duct system.”

Unlike her “brother” James, T had no effect on developing Jenny’s Wolffian ducts leaving her with neither set of duct. This explains why Jenny has testes instead of ovaries, as she has the SRY gene, but also female genitals, as her body does not respond to T to create male genitals.

Jenny’s lack of response to T is due to having a mutation on an androgen receptor meaning that T cannot bind to it. In normal circumstances, T binds to an androgen receptor and then both move into the cell nucleus to increase transcription of certain genes. Since T cannot bind to a receptor in Jenny’s body, it cannot upregulate other proteins that will create male characteristics. As a result, Jenny developed female traits instead of male ones:

“Making a female, in many ways, is easier than making a male – the external structures develop in the female direction in the absence of any hormonal signal.”

Jenny being, according to Dr. Hooven, very feminine is not just the result of ineffectiveness of T on her body. Oestrogen, in many ways the female equivalent of T, is actually produced from it:

“in everyone, all estrogen comes from testosterone (or other androgens). In other words, testosterone is an estrogen precursor.”

[Carole Hooven, being American, uses the US spelling ‘estrogen’.]

Therefore, Jenny has had the effects of oestrogen produced from T.

The chapter ends by briefly talking about differences in behaviour in boys and girls, referring to the famous nursery rhyme:

“What are little boys made of? Snips, snails and puppy-dog’s tails…What are little girls made of? Sugar and spice and all things nice.”

Carole Hooven writes about her young son Griffin, whom she dedicated the book to, to highlight typical boy behaviour – fantacising about destruction of planets, battles, rough-and-tumble play, etc. As mentioned in the first chapter, some feminists take issue with assumptions about typical boy and girl behaviour and there are a number of feminists who present counter-arguments that distinctive behaviour between the sexes is a result of culture rather than biology.

There is an experiment, for example, in which baby boys and girls were dressed to look like the opposite sex and presented to test subjects this way. The subjects said that the boys who they thought were girls showed behaviour that was typical of girls (and vice versa for girls dressed as boys) reflecting that attitudes can be reinforced by how children are presented to us. I once watched a documentary that also presented this experiment. However, it’s important to note that it’s harder to tell if babies are boys or girls, other than the obvious checks, than it would be if this experiment was performed with toddlers or older children. Baby behaviour is also fairly consistent between the sexes although there are still some differences.

The author contrasts her son’s play with what is typical of most girls:

“What kind of fantasy play do girls tend to act out? Those that involve relationships, romance, and domestic concerns, like getting married, parenting, going shopping, or taking care of household responsibilities. Much of girl’s play, in contrast to that of boys, omits the blowing up of planets but instead focuses on coming together and finding safety after being under threat.”

Although girl’s play may not include conflict of the planet-blowing-up variety, I would point out that relationships, romance and domestic concerns are not free of conflict themselves. Consider the popularity of soap operas and gossip magazines, which involve lying, cheating partners, abuse, and murder often to a degree that would be extreme in real life. These genres have a predominantly female audience than a male one, albeit women instead of girls. There’s a clip from the comedy show Taskmaster whereby the comedians have to create their own soap cliffhanger. The female comedians come up with this scene which wouldn’t look out of place on a soap like Eastenders.

Boys and girls’ toy preferences are also different as boys tend to like toys relating to transportation or weapons whereas girls tend to like toys such as dolls and tea sets. The author points out that boys who have been banned from playing with toy weapons for fears it will influence dangerous behaviour often use other toys as weapons instead:

“Boys, it seems, are resistant to efforts to condition them away from battle and weaponry.”

I would also argue that this assumption that boys playing with toy guns or other weapons may cause them to be violent is a little shallow. Does girl’s play make them entirely caring and non-violent? I often think feminists make more stereotypical assumptions about sex differences than other people do.

Chapter 4: The Effect of T on Male and Female Behaviour

A second DSD condition is described in this chapter using another case study. An Indonesian girl called “Taman” started to develop a penis at puberty as well as other male traits like a drop in voice. Taman, like Jenny in Chapter 3, was biologically male, or at least intersex, but had the physical features of a girl. Unlike Jenny, Taman’s androgen receptors work. The problem was also not with T, but another androgen, dihydrotestosterone or DHT. This is produced from T by the enzyme 5-alpha reductase. DHT provides extra stimulation in the development of the penis and scrotum.

5-alpha reductase didn’t work in Taman’s body, a condition known as 5-alpha reductase deficiency (5-ARD), so T was not converted into DHT. As a result, Taman’s penis did not develop properly until puberty when an increase in T was sufficient to do it.

Interestingly, although Taman was thought to be a girl until puberty, she (or he) was always a “tomboy” or a girl who displays behaviour more typical of boys. Carole Hooven argues that T had had an effect on Taman’s brain but not on Taman’s body, indicating that differences in boys and girls’ brains start in the womb therefore nobody is a ‘blank slate’.

Men with 5-ARD have been found worldwide, and often in remote areas where inbreeding and lack of medical intervention is common. In the 1970s, the endocrinologist Julianne Imperato-McGinley studied a group of 5-ARD-affected children in the Dominican Republic. Like Taman, some of the children thought to be girls seemed to turn into boys at puberty. Such children were given the name “guevedoces”, literally “eggs at twelve”, referring to the development of male genitalia. Following puberty, most “guevedoces” identify as men which is likely because they felt more like boys than girls during childhood. Countries like Indonesia and the Dominican Republic have more traditional expectations of men and women so it can be difficult for such people as Taman or the guevedoces to fit in although they may be recognised as a “third sex.”

These cases, along with Jenny in the previous chapter, show that there is a complexity to male and female identity as intersex people, as well as people with “gender dysphoria”, do exist. Nonetheless, it’s also important to consider that there must be distinctions between males and females otherwise we would not notice when there are these complications. Professor Imperato-McGinley’s research was published in the journal Science in 1974. A “feminist scientist” named Ruth Bleier accused Imperato-McGinley of “lacking scientific objectivity” which seems like the pot calling the kettle black.

DSD conditions enable us to see the importance of hormones in influencing male and female differences as the ineffectiveness of certain hormones like T or DHT is transformative. Since it is unethical to perform potentially dangerous and life-changing experiments removing gonads or altering sex hormones in humans, conditions like 5-ARD are useful in researching how the sexes differ and develop over time.

An alternative is to study other animals like rats. Rats who, depending on their sex, have been castrated or had their ovaries removed display behaviour that is often atypical. For example, castrated male rats will show indifference to fertile female rats but, as seen in Chapter 2, will behave like normal males when injected with T. Female rats with removed ovaries will not show attraction to males or display the reflexive “lordosis pose” common in many female animals. In the lordosis pose, female mammals lower their front legs, curve their backs inward and stick their rear end up to present themselves to males for mating.

Since castrated male rats recover their sexual behaviour following injection of T, it was theorised that female rats given male levels of T would show the typical male response. Experiments in the 1930s tested this hypothesis on pregnant rats but found no difference in behaviour from females. However, the female offspring had genitals that resembled male’s. Later it was suggested that genes were responsible for the programming of sexual behaviour rather than hormones.

In the late 1950s, the scientist William C. Young reported an experiment in which T was given to female rats in utero and then again in adulthood. Unlike the previous experiment, these female rats displayed male-typical sexual behaviour such as mounting. This suggested that the T given later activated areas of the brain that had been developed by T in the womb. Young performed a similar experiment with guinea pigs which had identical results. Also, female guinea pigs given T in the womb and whose ovaries were removed would not show female sexual behaviour when injected with oestrogen or progesterone. In contrast, females who had developed normally but who later had their ovaries removed would show sex-typical behaviour when given these hormones.

Why is it necessary for T to act on the brain in utero to prepare for a second increase in T during puberty? One reason may be to initiate distinctive play behaviour in male and female young. Play behaviour in children and baby animals is thought to be in part preparation for behaviours in adulthood. Males in many animals will play fight more than females which is indicative of male competition when males mature. Males who are prevented from play fighting have been shown to be less likely to reproductively successful.

Congenital adrenal hyperplasia (CAH) is a rare genetic disorder that has similar effects as the experiments giving T to female rats and guinea pigs. During pregnancy, CAH boys and girls are exposed to high levels of T due to, in most cases, an inability to produce cortisol from progesterone. Instead, the body produces excessive intermediate androgens like T. Since girls are more sensitive to androgen exposure, the effects of CAH are often more dramatic than in boys.

Experiments have been carried out on CAH-affected boys and girls to see if their behaviour is any different from healthy boys and girls. In a 2005 study, children with and without CAH were given a variety of toys to play with, ranging from boy’s toys, girls’ toys and neutral ones. CAH girls were found to prefer playing with boy’s toys than ordinary girls and parents had little effect on this preference. CAH boys showed little difference in their play preferences with ordinary boys. Girls with higher T than average have also been observed to play with boy’s toys more.

Sport is a common domain for play in both sexes throughout their lives and T’s effect on performance in sport is explained in the next chapter. This will be covered in Part 2.

MMM#11: Force Makes the World Go Round?

Since the news is currently dominated by Russia’s invasion of Ukraine, I thought I’d write down some of my own thoughts about it. I am by no means an expert on either Russia or Ukraine; nor am I an expert on many of the events that led up to this moment. I was born just over a year after the Berlin Wall came down in 1989, which signified for most people the end of the Cold War and the fall of Communism, so my knowledge about the conflict between the East and West, as well as the Soviet Union, has always been after they had ended. Of course, we may be entering a Second Cold War where the threat of nuclear annihilation emerges once again in people’s minds.

I’ve been very interested in historian David Starkey’s analysis of what is going on in Eastern Europe. He has recently started a YouTube channel, which he may have created because of his own “cancelling” after making some clumsy comments about slavery, where he talks about various events in history and has given his own perspective on the Russia-Ukraine conflict. Even if you don’t agree with everything David Starkey says, I recommend checking out his channel.

In this video, Dr. Starkey argues that the West’s problem with dealing with Russian President Vladimir Putin is that we think “that everybody should have exactly the same values as a nice, sensitive, woke, public schoolgirl aged 16.” In reality, there are many different perspectives from our own. Although the media believes that Putin has gone mad and is losing the conflict, David Starkey argues:

“Putin is intelligent. He is informed. He is a careful, strategic thinker. He knows what he’s doing. And he’s prepared himself to do it.”

David Starkey

This does not mean that Starkey likes Putin, as he says:

“I certainly think he’s bad. At least, he’s bad according to our values.”

Like a lot of people, David Starkey compares Putin to Adolf Hitler but this comparison, in Starkey’s case, is for a particular reason:

Mein Kampf said exactly what Hitler was going to do, and why he was going to do it. In a series of speeches, over the last two years, Putin has said exactly what he is going to do in Ukraine, and… why he’s going to do it.”

The main point of this video is that, according to Starkey, Putin sees himself as a Tsar who wants to emulate Russian historical figures like Peter the Great and Catherine the Great who conquered the fought over land that would become Ukraine. If Ukraine is to undergo “decommunisation” or “denazification”, this is to be achieved, in Putin’s mind, by “reabsorbing Ukraine into the Russian Empire.” The West doesn’t understand this because:

“Putin, unlike us, understands power. Power, and the role of force. We thought we could dispense with it. He knows you can’t.”

David Starkey makes this point further when he notes Putin’s response to a journalist asking him how could a good country actually declare war:

“Why do you think if you are good, you can’t use force? Goodness implies the possibly to defend yourself.”

Vladimir Putin

To Starkey, until recently, everyone in the West would have agreed with this statement. He makes a similar point in this GB News interview with Mark Steyn:

“We have lived in a myth since the Second World War… Broadly speaking, we haven’t had big wars because… we imagined, we in the West, that we didn’t need force. That force was nasty…”

David Starkey

In another GB News interview, with Nigel Farage, Starkey says:

“The reason that we’ve had the Liberal World Order is because the World great power, America, was prepared to fight. Let’s be honest, America is no longer prepared to fight.”

Less and less money has been spent on defence and more has been spent on “welfare, health and pensions.” Force, for David Starkey, is necessary to maintain the freedoms and beliefs we share in the West but, he believes, we have foolishly discarded this idea.

This is a fascinating point, particularly if we consider the hysteria that surrounded some of Donald Trump’s actions when he was President. Trump’s forceful behaviour was thought by many in the mainstream media to be increasing the likelihood of war. In actuality, although Trump wasn’t perfect, during his Presidency there were attempts at negotiations between the West and potentially dangerous leaders like Vladimir Putin and Kim Jong-un and no escalation of conflict in other countries. Compare this to what has happened since Joe Biden became US President.

As the main focus of this blog is issues relating to men and women, it’s worth asking whether the increase of women in the public sphere over the past few decades has led to a de-emphasis on force, defence and power and more emphasis on personal well-being and non-violence. I’ve written elsewhere that I disagree with some of the assumptions that have been made about women’s effect on society – mainly the idea that women have excessive empathy and compassion which can be detrimental (see here for more detail), but it’s still possible that women’s influence has had some effect.

Nevertheless, the importance that societies may or may not place on force is not restricted to differences between men and women as it can divide many thinkers, regardless of sex. Thomas Sowell has written about the contrast of ideas that has divided many intellectual figures over centuries, of which the use of force is only one of them, in his great books A Conflict of Visions and Intellectuals and Society.

In some ways, the conflict in Ukraine is another battleground in the ‘Culture War’ which is dividing the West. People in the UK, US and Europe waving the Ukrainian flag and banning anything relating to Russia could be seen as examples of virtue signalling and cancel culture given that they don’t require much effort to do. There has also been pressure on large corporations like McDonald’s and Coca-Cola to suspend their activities in Russia without taking into account that this may backfire if Russian people feel they are been bullied and choose instead to rally behind Putin. I’ve also noticed that we are now supposed to write Ukraine’s capital city Kiev as “Kyiv” and other Ukrainian cities like Odessa are now written “Odesa” which I initially thought was a typo when I first saw it written this way. This is presumably to show how cultural, sophisticated and understanding we are in our solidarity with Ukraine.

It’s true that there has been almost universal support for Ukraine and universal condemnation of Putin’s actions, but, as David Starkey has described, there is still debate over the causes of this war and what Vladimir Putin and Russia want to get out of it. In the media, for example, Ukraine has been presented as a free, progressive, liberal democracy with a heroic leader in Volodymyr Zelensky whereas Putin is portrayed as a insane tyrant who has attacked Ukraine without provocation.

Alternatively, there is little attention paid to how the Western world, and NATO in particular, has contributed to Russia’s actions or the corruption in Ukrainian politics. As Peter Hitchens, in his Mail on Sunday column, writes:

“I know that our policy of Nato expansion – which we had promised not to do and which we knew infuriated Russians – played its part in bringing about this crisis. I know that Ukraine’s current government, now treated as if it was almost holy, was brought into being by a mob putsch openly backed
by the USA in 2014. I know that the much-admired President Zelensky in February 2021 closed down three opposition TV stations on the grounds of ‘national security’…I know that the opposition politician Viktor Medvedchuk was put under house arrest last year on a charge of treason. Isn’t this the sort of thing Putin does?”

Peter Hitchens, Mail on Sunday

I don’t support Putin or what is happening in Ukraine but neither do I think the West is entirely blameless. Part of me wants Putin to succeed in his invasion, only because I think that things might be worse if he fails and attempts a more extreme option, such as potentially using nuclear weapons. The suffering of Ukrainians may be worse if the West pushes Ukraine to resist against the odds. If we are not willing to use force ourselves, why should we expect others to?

I have no idea how the war in Ukraine will play out but I agree with David Starkey that we cannot understand our enemies unless we understand how they think.

Book Review: ‘Bad Men: The Hidden Roots of Sexual Deception, Harassment & Assault’ by David M. Buss (Part 3)

This is the final part of my review of this book. I apologise in advance, this post is even lengthier than the other ones.

Chapter 7: Sexual Coercion, Harassment and Rape

The final three chapters explore the issue of sexual coercion by men against women which may range from harassment to more extreme forms – assault and rape. In keeping with the rest of the book, David Buss tries to put forward an evolutionary perspective alongside social and cultural ones but stresses that doing so does not justify sexual coercion or make it inevitable:

“Just as modern science has created novel vaccines and drugs to eliminate many “natural” diseases, with enough knowledge we can create personal, social, and legal environments that curtail or suppress the components of male psychology that contribute to sexual coercion.”

The author cites the work of Owen Jones (no, not that one!), a legal scholar who notes that laws against sex crimes, like laws in general, are designed to try to influence human behaviour:

“For laws to be maximally effective, Jones argues, their designers must have an accurate model of human nature. The more accurate the model, the more effective the legal levers.”

One problem with this approach, in my opinion, is that it treats humans almost like machines that can be fixed and modified depending on the technology available. Even the words “designers”, “model” and ‘”levers” imply flaws in human nature are like an engineering problem that can be repaired using scientific knowledge. This more detached, clinical approach conflicts to some degree with traditional understandings of human nature in cultural and religious contexts which are predicated on morality. Laws in this context are determined on actions like sexual assault being deemed to be morally wrong. People who favour the scientific approach may consider this reasoning to be obsolete or fundamentally flawed but this would dismiss centuries of thought on human nature and its complexities. There is merit in studying the psychology of sexual coercion and assault which may be helpful in decreasing it, but there is still the problem of how such studies are interpreted and their influence on society. Feminists, for one thing, will be biased in women’s favour.

The psychology behind sexual harassment and assault are explored in this chapter. For example, women may experience unwanted looks from men which, while less intrusive than other behaviours, can still be upsetting. Certain men may find themselves drawn to looking at attractive women and find it difficult to look away thereby displaying “attention adhesion.” Men staring at women for too long can obviously lead to women feeling uncomfortable. It may shock the reader to discover that pleasure centres in the brain are activated when men look at images of beautiful women. This is harmless for the majority of men, but can cause problems for attractive women in the presence of sexual predators.

An interesting point is made here about evolutionary mismatch offering a possible explanation for the confusion men and women can feel regarding sexual harassment. Traditionally, men and women worked predominantly in separate workplaces which meant the majority of their interactions with the opposite sex would be amongst friends and family. Although male and female-dominated workplaces still exist, men and women now work much more often in “sexually integrated” environments, which obviously increases the chances of sexual attraction, flirting and all of the complications that this can create. A young, attractive woman may use her looks to get ahead at work and an older man may offer promotions to such women in return for sexual favours – this is known as “quid pro quo harassment.” Dr. Buss also makes the argument that mixed workplaces decrease the presence of women who may act like female kin in protecting a woman from male harassment. However, this doesn’t take into account ‘white knights’ – i.e. men who take it upon themselves to be overprotective and deferential towards women. It won’t be a surprise to learn that over 80 percent of complaints about sexual harassment are from women. Dr. Buss writes:

“Male power and patriarchy are clearly part of the picture. Men historically created the workplace rules and influenced social norms that overlooked sexual harassment.”

While it’s possible that men may have overlooked certain issues that women might face in the workplace due to being male, societies have often denounced men who were lecherous or predatory and you can find depictions in old films and TV shows of women slapping men who are too forward in their advances.

Studies have apparently found unconscious links between power and sex but only in men who are likely to sexually harass:

“In short, power and sex are linked, but primarily in the minds of a subset of men. This may explain why only a minority of men in positions of power over women sexually harass them; many men with power do not.”

It makes sense for power and sex to be linked since powerful, high status males are more attractive to women from an evolutionary standpoint and it is suggested in the book that men strive for power for this reason.

The author also points out that women’s perception over what constitutes sexual harassment can vary depending on their attraction to the man in question:

“Women evaluated sexual advances from a physically attractive man as significantly less disturbing than advances from a physically unattractive man. Workplace sexual advances from men low in desirability, apparently, are more upsetting.”

It is difficult for men in this situation, however, to assess if the woman they want to approach is interested in them unless men make an advance in the first place. In keeping with the rest of the book, the men deemed most likely to sexually harass are the ones who pursue short-term mating strategies and are high in the Dark Triad personality traits.

Harassment can vary in its intensity and in severe cases can lead to sexual coercion and rape. Dr. Buss carried out a study with a colleague in which men and women were asked if they ever felt their lives were in danger. A small percentage of women feared that they could be raped and then murdered despite the fact that this is a rare occurrence. Another paradox noted is that women fear stranger rape, which makes up 10-20 percent of such cases, rather than acquaintance rape, which makes up 80-90 percent. It is suggested that this may be another example of evolutionary mismatch reflecting when humans lived in small groups and could be attacked by outsiders but, for me, this greater fear of strangers is likely because humans have a general fear of the unknown. The author also suggests that the low rates of stranger rape may be a direct result of women’s greater fear of it as they will be more wary of being attacked by a stranger.

Since the book examines possible evolutionary explanations for sexual coercion and assault, the question of whether men have developed adaptations to rape is explored which Dr. Buss acknowledges is a controversial proposition. The evolutionary scientists Randy Thornhill and Craig Palmer have put forward two competing theories for the origin of rape:

  • Randy Thornhill proposed that rape is an adaptation to allow men to sexually reproduce even if a woman is unwilling.
  • Craig Palmer argued that rape is a by-product of other male traits such as aggression, a desire for sexual variety, short-term mating etc.

Several studies have been carried out to test the veracity of these theories such as getting men to listen to women describing episodes of consensual sex or rape. Most men were aroused by the consensual sex descriptions but not the rape ones. Not surprisingly, convicted rapists were aroused by both scenarios. Again it seems that a small subgroup of men are most likely to engage in these extreme behaviours. Moreover, they tend to score high on psychopathy and narcissism and low on empathy. Later on in this chapter the author writes:

“A small percentage of men leave a long trail of victims in their wake, whether criminally charged or not. The fact that most rapists are serial rather than onetime rapists partially resolves an apparent paradox noted in the scientific literature – that a large number of women report being raped, but a much smaller number of men report committing rape.”

One theory that has been suggested to explain how rape could have been an adaptation posits that males deprived of opportunities to have sex with women consensually – undesirable, low status males for example – could do so by force. This has been called the “mate-deprivation hypothesis.” The fact that most convicted rapists come from poorer backgrounds is possible evidence to support this, but David Buss argues against the mate-deprivation theory. According to Buss, lower rates of convictions for men in higher social groups, such as Harvey Weinstein, are the result of them having the wealth and power to silence or pay off victims.

Apparently, men in college who are popular and have high status, which means they will be more successful with women, are more likely to admit to behaviour that would be defined as rape. The reasoning here seems to be that such men have a sense of entitlement which means they will prioritise their own wants and desires above others:

“the wealthy, it turns out, tend to be more indifferent to other people’s misery. According to this hypothesis, it is popular, high-status macho men, not mate-deprived low-status men, who are more likely to rape.”

It’s a good job women don’t find these kind of men attractive then isn’t it? In my view, the psychology of the subset of men who are most likely to harass or rape women is more important than their socioeconomic background, although their motivations may be influenced by being rich and entitled or poor and desperate.

David Buss further writes:

“This fact is exemplified by a quote from television celebrity and subsequently elected president Donald Trump, boasting about getting away with sexually assaulting women precisely because of his status: “When you’re a star they let you do it… You can do anything…Grab them by the pussy.”

Dr. Buss risks dividing his readers here by using a deeply partisan figure like Donald Trump as an example and it hinders the objectivity he presumably wants to maintain. While Donald Trump’s comments were crass and nobody could accuse him of being a perfect gentlemen, the important line to consider in what he said was “they let you do it.” This implies that whatever Trump was doing was not met with resistance from the women. He might have also said “grab them by the pussy” as an EXAMPLE of what you could do if you were famous enough rather than something he has actually done. Are we supposed to pretend that some women don’t throw themselves at powerful, high status men?

Other studies suggest that men who use some kind of sexual coercion tend to be more successful with women which is used as further evidence that higher status men are more likely to sexually assault. However, doesn’t this imply that women are receptive to some coercion from men? While this doesn’t excuse sexual assaults, it does suggest there is a ‘grey area’ in a lot of cases of sexual coercion. It should also be noted that some women might be motivated to prosecute higher status men for harassment/rape than lower status men since women may receive greater compensation and status for doing so, reflecting how people will generally sue wealthier people, who can afford to pay out, rather than poorer people. Such a suggestion would be too taboo for this book though.

The case of Paul Bernardo, a Canadian serial killer and rapist, is another interesting example countering the mate deprivation idea of rape since Bernardo was attractive and could pick up women easily. Again, what is more important, in my view, is the psychological underpinnings of sexual predators rather than their high or low status. The author concludes from all of this that Randy Thornhill’s theory of rape being an adaptation is incorrect.

David Buss also explores Susan Brownmiller’s claim that rape is “a conscious process of intimidation by which all men keep all women in a state of fear.” Several studies have been carried out to try to deduce how men relate to rape such as exploring sexual fantasies and whether men would rape women if they could get away with it. Judging from questionnaires, men who might assault women are a minority but it is pointed out that women have been raped by men in wars; when the rule of law has broken down. This is possibly due to such women being seen as the ‘enemy’ by the perpetrators. Some men may have sexual fantasies about raping but the book doesn’t mention that women may also have sexual fantasies about being raped and, in some cases, may have orgasmed during a rape, not that this justifies it.

Marital rape is another topic explored. By 1993, every state in the USA had laws prohibiting it but other countries still do not have laws against it. Laws against marital rape are another way in which feminist thinking has influenced changes to deal with an apparent oversight by men. Countries without such laws are gradually decreasing though as Dr. Buss notes:

“The cultural progression of laws and attitudes surrounding this form of institutionalized sexual assault is rapid and moving in only one direction.”

I don’t share David Buss’ view that absence of marital rape laws are somehow “institutionalized sexual assault” but his view is one shared by many people. It seems likely to me that one reason why there was no law such as “marital rape” in the past is because of the difficulty in prosecuting a rape case within a marriage where sexual relations are expected to take place. It could be argued that, like domestic violence, there were already laws against assault that could cover such cases anyway. Were women too weak, stupid or helpless to use these laws if they needed to? Since David Buss is nearly forty years older than I am, you might think I have no place to lecture him on what people thought in the past, but I’m sure other people of a similar age or older than Dr. Buss could make the same point as I have.

Although David Buss rejects that rape is an evolved adaptation in men, he does think that aspects of men’s “mating psychology” such as desire for short-term mating, sexual variety and attraction to younger women does contribute to such behaviours occurring, which is more in line with the idea that rape is a by-product of these characteristics. I would agree with this alongside the likelihood of psychopathy or some other mental disorder.

Chapter 8: Women’s defences against sexual assault

The eighth chapter opens with a quote by Gavin de Becker about most men fearing being laughed at or humiliated by a romantic prospect while most women fear being raped and murdered. A similar quote is often attributed to The Handmaid’s Tale author Margaret Atwood. Whether or not this is true, in reality men are more likely to be murder victims than women and can be raped in prison or in war.

It is true that women have being raped and murdered by men throughout history and often in times of war. In general though, women of reproductive age were kept as sex slaves whereas men were murdered. This has been evident from archeological studies showing men seemingly killed in battle whilst younger women are absent. Genghis Khan is one historical figure who was notable for this particular practice and is thought to have countless descendants as a result.

Women may have developed adaptations to deal with this reality regardless of whether or not men have evolved adaptations to rape. Again, here David Buss puts forward possible evolutionary explanations for men and women’s behaviour.

There is a lot more feminist influence in this later part of the book as is indicated by the opening quote to this chapter. Whilst reading this, I began to wonder if David Buss had one of his (female?) students help write it for him. I’ll show some quotes to illustrate this soon. Since rape and sexual assault is an unpleasant and sensitive subject, I’ll try to be as clear as I can where I disagree with what is claimed in the book and not downplay the seriousness of rape.

To give an example of feminist influence, the author claims that while sexual aggression is rated as highly upsetting by women, men underestimate how upsetting women would find it:

“These findings were presciently predicted by feminist scholars who made a major contribution to the understanding of rape from the victim’s perspective.”

Do men seriously not sympathise with female victims? I find that hard to believe myself. How come the narrative of sexual violence is so skewed towards female victims if that’s the case? Surely if men have so much power in society, and so underestimate female feelings about sexual abuse, it would not be such a big talking point? Isn’t it also the case that “feminist scholars” have a particular axe to grind?

Another quote I wrote down in my notes while reading this book prompted me to write ‘What!’ at the side of it:

“because most police officers are men (87 percent in the United States) with a male sexual psychology, they may lack sufficient empathy for rape victims, which leads to greater leniency toward sexual predators.”

I know there’s currently a lot of animosity towards the police, but are we seriously to believe that officers wouldn’t sympathise with female rape victims because they are men? What about men’s protective instincts? What is described as leniency towards male sexual predators could simply be impartiality. If anything, the opposite is true in that society is pressured to side with women accusers – hence #believeallwomen – and condemn accused men. This distortion between what is claimed about rape cases and the reality reminds me of Peter Hitchens’ remark that rape is now seen as ‘”a crime against feminism.”

Nevertheless, there are obvious reasons for women to fear being raped as it can lead to unwanted pregnancy, sexually transmitted diseases and bodily harm. There may also be social costs to being a rape victim. For example, many women were raped during the Rwandan genocide and faced shunning from their societies because they were no longer virgins and had unwanted children. In some cases, a man might divorce a woman who was raped because of feeling cuckolded and she may be unable to find another man. There are psychological costs as well as a victim might lose self-esteem and be afraid of intimacy. It is possible for these reasons that female victims may conceal the fact that they have been sexually assaulted although I think this will be less common in Western countries. Concealment of assault also presents risks as it prevents victims from getting help with their trauma. This shows that there are legitimate reasons for supporting victims of rape but this needs to be balanced with other considerations.

It has been theorised that one possibility women desire men who are taller and stronger than they are is to deal with the potential threat of male rapists. Sarah Mesnick and Margo Wilson put forward the “bodyguard hypothesis'” which suggests that women pair-bonded with such men to deter sexual aggression from other men. Dr. Buss notes that women could benefit from choosing strong men for many other reasons as well.

The chances of a woman being raped vary on different factors: married women are less likely to be raped than single/unmarried women possibly due to lifestyle differences and women who are surrounded by friends are also less likely to be sexually assaulted since friends can act as bodyguards. Women are in fact more fearful than men of being victims of many different types of crime even though they are, on average, less likely to be so. This is known as the “fear of crime paradox.” One reason for this paradox is possibly because women’s fear of sexual assault, where they are more likely to be victims than men, drives their fear of other crimes like mugging or robbery.

There is also another paradox, which has already been mentioned, of women fearing stranger attacks more than attacks from acquaintances even though the latter is more common. Dr. Buss also explains that infants have an innate fear of strangers that is evident cross-culturally and writes:

“Infants do not fear all strangers equally. They show special fear of unfamiliar males, suggesting that male strangers have been more dangerous than female strangers.”

This may be linked to stepfathers killing off children of rival males but I would replace “have been” in this quote with ‘appear’ since males tend to be larger and more intimidating than females. We are better able to perceive threats that appear to us than we are unknown threats, hence the expression “better the devil you know than the one you don’t.” Infanticide is actually more often committed by women although this is to some extent related to women being more likely to look after infants than men.

Feminists don’t really help women by obsessing over rape either. Since younger women are more likely to be victims of rape than older women, they tend to be more fearful of it and so gradually become less fearful as they get older. David Buss makes a good point that women would be better off if they were aware of their own “psychological wisdom” in this regard instead of believing that they are always vulnerable to rape. Women could also benefit from becoming physically fit and taking self-defence classes as this correlates with reduced fear of sexual assault.

Women are more likely to fear being raped at night than during the day and are also more likely to fear rape if they know other women who have being victims. Likewise, women fear rape more if they have been sexually harassed. The fact that women who fear rape the most tend to avoid and be more cautious in certain situations is suggested as evidence that these actions are an adaptation. However, this behaviour is common for many things that people are afraid of. The author believes that eliminating the actual threat of rape using scientific knowledge would help the costs women may suffer from being fearful of it.

Vigilance is one response to threats which activates the body to become alert and watchful and heightens the senses. The “auditory looming bias” is one example of this as people overestimate the closeness of fast-approaching sounds than fast-receding ones. “Freezing” or “attentive immobility” of the body additionally increases sensitivity to sound, sight, etc. One study found that an attacked woman who retaliates aggressively by biting, punching, kicking or using a weapon is around 50 percent more likely to escape being raped than a woman who doesn’t resist at all. This reinforces the previous point that women who know self-defence may be less likely to be afraid of rape, although here Dr. Buss says the evidence is mixed. Screaming, yelling and running away are also effective. Similarly, interviews with rapists suggests they avoid targeting women who they think will fight back. In contrast, pleading with the rapist is less likely to work.

However, even the most athletic and physically fit woman may not be able to avert a rapist as she may be overpowered, tied up, drugged or threatened with a weapon. A common defence mechanism is this situation is “tonic immobility” in which the body becomes numb by decreasing blood pressure and analgesic or insensitive to pain. 37 percent of rape victims are said to have experienced tonic immobility leading to a separate term called “rape-induced paralysis.” One evolutionary theory for tonic immobility suggests that it minimises the severity of an attack if escape is not possible. Whatever advantages tonic immobility may have during a rape are inconclusive though. Post-traumatic stress disorder (PTSD) is also common in rape like it is in many highly intense and stressful situations. This may be an adaptation to cope with traumatic events.

One potential complication from victims experiencing tonic immobility is the possibility that the police, judges and juries may question claims of rape if a victim didn’t fight back. There may also be doubts of a claim of rape if a woman’s body responds to the act like it would if intercourse was consensual, such as her having vaginal lubrication. Dr. Buss notes that both tonic immobility and lubrication are involuntary responses so should not be used as evidence against an accusation of rape. In my view, a lot of this depends on if the case is a stranger rape or acquaintance rape which brings its own complications. It is argued that rape is underreported and one reason is because of the prevalence of victim blaming but I’m less convinced about this seeing as sympathy is often with women over men.

There’s definitely a discussion to be had about rape and how to prosecute it but that would involve looking at it from different perspectives, not just feminist ones.

Chapter 9: The “sex gap” and conclusion

The final chapter in this book looks at the cultural issues of sexual assault and what the author believes are ways to reduce them:

“I am convinced that deep knowledge of our evolved sexual psychology, and especially the ways in which that psychology differs on average between women and men, is indispensable for reducing conflicts between the sexes that have been ongoing for millions of years.”

Dr. Buss insists however that his ideas are merely suggestions to be studied further rather than solutions. “One sign of progress” according to the book is the well-publicised cases of Harvey Weinstein, Jeffrey Epstein and Ghislaine Maxwell which are evidence that “victims of sexual violence are coming forward and refusing to be silenced.” Another sign of progress is apparently the “zero-tolerance policy” for sexual harassment at work. While it’s a good thing if victims of sexual assault feel more confident speaking out about it, I’m less convinced by the development of #MeToo and other causes. It’s not as if sexual harassment is a recent discovery and there is growing intolerance towards those who criticise its excesses.

The sexual “arms-race” between men and women that David Buss described in Chapter 1 is now being fought in a rapidly changing world. Dating apps, for example, provide people the opportunity to meet an ideal mate but also give them, along with sexual deceivers and predators, abundant choices. Pornography is another example:

“Online pornography allows individuals to explore creative sexual possibilities they never knew existed but also creates entirely unrealistic expectations for real-life sexual interactions. Sex dolls, sex robots, and virtual sex technology… may diminish some of the rage of incels or even reduce rape rates but also may exacerbate the harmful sexual objectification of women.”

One solution is to understand the “gap” between men and women’s sexual psychology. Failing to recognise sex differences in mating psychology, according to Dr. Buss, is the biggest hindrance to reducing conflict. One example discussed previously is men mistaking friendliness from women as sexual interest. A second example is the difference in “sexual disgust” between men and women:

“Are men aware that women find more things sexually disgusting than they do? Judging from the number of men who send unsolicited photographic images of their decontextualized genitals to women, the answer is a resounding “no.””

A statistic presented here claims that 27 percent of milliennial-age men in the UK admitted to sending such images to women and 30 percent of men think that women will find the images “sexy.” It’s important to note, like with any other statistic, that the numbers only apply to the people in the sample group. In reality, the claim should be: ’27 percent of millennial-age men in the UK surveyed by this particular study admitted to sending pictures of their genitals to women.’ David Buss argues that some men “commit a major mind-reading error” as they fail to understand that women would be disgusted by “dick pics.” Are men really so ignorant about this though? Boys often like to tease girls by doing things that will ‘gross them out’ as anybody who grew up with a sister will understand. While I don’t approve of men sending pictures of their genitals to women, the fact that women would be especially disgusted by such images may be the main motivation in sending them. Also, most men don’t find images of women’s genitals particularly sexy, unless breasts count as female genitals. Further examples of sex differences include levels of anxiety, preference for casual sex and sexual variety, regret for missed sexual opportunities, effect of visual stimuli etc.

It is here that the author reverts back into feminist mode. David Buss also believes that men “vastly underestimate the emotional horrors” women who have been raped experience as explored in Chapter 8. I’m more sceptical of this idea as I’ve mentioned before. Furthermore, the book argues that men should be required to learn “about the harms women suffer from sexual assault, from anxiety to PTSD” as if we aren’t aware of this fact already. Men may not recognise trauma suffered by women who are raped as there are “no real parallels in men’s minds” which ignores that men can be raped by men as well. David Buss believed he was “unusually empathetic” towards rape victims because of his own studies and from reading accounts of rape victims such as Alice Sebold’s book Lucky. This book was in the news recently as the man who was convicted of Ms. Sebold’s rape was found to have been wrongfully imprisoned!

Perhaps wearing a ‘This is what a feminist looks like’ T-shirt while writing it, Dr. Buss says:

“I discovered that I too had vastly underestimated the psychological toll that sexual assault inflicts on women. Undoubtedly I still cannot fully grasp, after decades of study, the psychological toll it takes on women. Men may think they understand, but I don’t think they ever can fully. I hope that this book helps men move a little closer to bridging the gap.”

My T-shirt remark might be too dismissive: I don’t doubt the sincerity of David Buss’ feelings here and I don’t want to come across as unsympathetic towards victims of rape. However, I question the insistence that men have so little understanding of female suffering from sexual assault, and that sexual assault has such catastrophic effects on women. Obviously, Dr. Buss has more knowledge about this than I have, but there’s still a problem with viewing women as permanent victims and men as heartless and unsympathetic towards them. Why should I feel bad about the actions of other men? And can’t excessive sympathy result in infantilising women? At the risk of sounding flippant, I’m not buying a ticket for Dr. Buss’ guilt trip. He’s likely a decent guy with good intentions, but as the classic saying goes, the road to hell is paved with good intentions.

David Buss argues that if we understand the gap between men and women’s sexual psychology, we can, as underground tube stations signify, “mind the gap” and promote understanding between the sexes. Notwithstanding the logic behind this, I have problems with the solutions which are suggested here.

For instance, the author questions the validity of having a “reasonable person” rule for laws such as stalking and sexual assault, since men and women differ in anxiety levels amongst other things. Although Dr. Buss concedes that writing laws as sex-neutral is laudable, he states that:

“a sex-neutral law can harm women, especially if the judge… is a “reasonable man” and consults his own intuitions about fears and emotional distress, or if the jury is composed of a combination of “reasonable men” and “reasonable women.””

Dr. Buss suggests that a “reasonable woman” rule could be used instead. The author compares this to studies in medicine which have found that certain doses of drugs affect men and women differently, which means that the sex of the patient will determine the treatment given. If laws are based on human nature, David Buss argues:

“If that nature differs between women and men, then perhaps laws, like medicine, need to take those differences into account.”

The problem here is that medicine and the law are not the same thing. Law is based more upon ideas of morality and philosophy than it is on science, even though both morals and philosophy play an important role in medicine. Like I mentioned before, treating law and human nature in a purely scientific way has its disadvantages. While many people recognise the dangers of treating men and women as exactly the same, there is also danger in treating men and women as completely different, such as in areas like the law where it can lead to preferential treatment of one sex over the other. How far do we go down this road? Should we have individual laws since people differ on an individual level? In future, I wouldn’t be surprised if there are people advocating for laws preventing male judges from presiding over rape cases, or only all-female juries being allowed, or even doing doing away with juries altogether.

Sexual conflict could also be reduced with the “crumbling of patriarchy.” I’ve already gone into my disagreements with the author over the motivations behind “patriarchal laws” in other countries, which, to my mind, are based on many things other than men simply wanting to oppress women. The author writes favourably about developments such as the #MeToo movement and the introduction of marital rape laws whereas I am less encouraged since these advancements are based upon the narrative of women being controlled and victimised by men. While I don’t believe that women should be mistreated, many of the social changes relating to men and women that have occurred in recent decades are based on biased and sometimes inaccurate assumptions. Here, Dr. Buss writes:

“Patriarchy is collapsing – its institutions, its social norms, and the expression of unseemly mating mechanisms that gave rise to male advantage. But what are those mating mechanisms that led to patriarchal institutions and social norms to begin with? And how easily can the expression of those mechanisms be suppressed?”

This quote wouldn’t look out of place in a women’s studies textbook, if such things even exist. It is possible that David Buss is forced to say these things to avoid jeopardising his career? I understand that he is less free to speak his mind if he thinks differently, but I don’t think I could be so in line with feminist thinking as Dr. Buss appears to be if, privately, I was against it. Given his age, it is possible that Dr. Buss has been influenced by his younger (and mostly female?) students and thinks their views are more “enlightened” than his own.

David Buss does point out that certain aspects of “patriarchy” are the result of female mate preferences:

“Feminist scholars rightly stress the importance of power in sexual conflict. It must be recognized, however, that men’s motivations for power, status, and resources exist in part because women have preferred to mate with men who possess power, status, and resources. Neglecting this part of the causal origins of sexual conflict will impede efforts to alter it.”

The argument presented here is whether women’s preference for high-status men can be altered in ways which may reduce sexual conflict. It is pointed out that women prioritise many qualities other than status and resources such as kindness and the author describes knowing a woman who has paired with a lower status man after bad relationships with higher status ones. Additionally, modern women no longer require men for protection and resources as they once did which may have an affect on male behaviour. This however doesn’t take into account that environments can change suddenly and a safe, healthy and wealthy society could collapse following a catastrophe which would make traditional male traits desirable again.

Another strategy is to “curb male possessiveness” which may lead to jealousy and violence as described in previous chapters. The book states that this possessiveness is “one key cause of patriarchy”:

“One way to curtail men’s proprietary mindset is to empower women – a trend that started with first-wave feminists who ushered in women’s right to vote and continues today with women’s increasing access to their own resources.”

There is a problem here though if men feel like they are being pushed to the sidelines or are confused about what their role is in society, which has been one outcome of these changes, whatever the benefits have come from them.

Other issues that may contribute to sexual assault are the sexual objectification of women and “sex ratios” – the number of women relative to men in an environment. A more sensible suggestion put forward is to avoid men who possess Dark Triad traits which can often be detected by their behaviour.

The book concludes by stating that “men’s sexual violence towards women remains the most widespread human rights problem in the world” which is indicative of the “world comes to an end. Women most affected” mindset. Sexual violence against women is a legitimate problem, but rather than seeing it as one problem among many, we’re supposed to think that women’s suffering is worse than any other group’s.

David Buss also writes:

“Female choice about when, where, with whom, and under which conditions they consent to sex is the deepest and most fundamental component of women’s sexual psychology. It is a fundamental human right. Although men have coevolved strategies to undermine it, that freedom of choice should never be compromised.”

This sounds reasonable on the surface, but what about women who make bad choices, such as having children with many different men and not taking any responsibility for their actions? An issue that I think modern societies will eventually have to contend with is how to have “female choice” alongside declining marriage and birth rates and men increasingly withdrawing from society. Can women make any choice they want to without thinking about how this affects men? While I’m not advocating for a Handmaid’s Tale society where women are completely subjugated, women do have to make compromises with men in order for the sexes to peacefully co-exist. The alternative will not reduce sexual conflict.

Summary: This probably wasn’t the best introduction to David Buss for me since I found a lot in this book that I disagreed with. On the other hand, there was plenty of interesting information that suggests his previous books are worth exploring. If the reader similarly found this review interesting, I recommend they check out Dr. Buss’ other books before deciding if they want to read this one.

Thank you for slogging through this review if you read the whole of it.

Book Review: ‘Bad Men: The Hidden Roots of Sexual Deception, Harassment & Assault’ by David M. Buss (Part 2)

Bad Men by David Buss | Hachette UK

Chapter 4: More relationship trouble

The primary focus of this chapter is jealousy and how it is involved in sexual conflict. The author describes how jealousy has a motivational function as it spurs us into action if we fear losing something, or, in the case of sexual jealousy, someone. The adaptive functions of jealousy in men and women are very similar since both sexes suffer “reproductive harms” if a relationship breaks down. Jealousy can be triggered by an imbalanced welfare trade-off ratio or a mate value discrepancy as described in the previous chapter.

Sexual jealousy, however, often presents itself differently in men and women as they can suffer from a broken relationship in unique ways. If a husband and father discovers his wife has been cheating on him, he may suspect he’s a victim of paternity fraud whereas a woman many fear abandonment and loss of resources if she finds out her husband has been seeing another woman. These fears and feelings of jealousy are understandably stronger in societies that have high paternal investment and/or are poorer and more traditional than Western countries. Men lower in mate value are also said to be more controlling.

Men fear sexual jealousy more than emotional jealousy whereas the opposite is true for women which matches the potential disadvantages that both sexes may suffer from infidelity or one person ending the relationship. This difference has been found by studies conducted worldwide. However, both men and women can be sexually and emotionally jealous as both are linked. In more traditional, non-Western countries, women also strongly fear sexual infidelity by their husbands as this could lead to diversion of resources or abandonment which presents harsher consequences for them.

Members of the same sex can also be targets of jealousy as they are potential mate rivals or mate poachers. For men, a ‘rival’ who exceeds them in status or strength may be a target of their jealousy whilst in women, a female rival who is considered more attractive than them will make them feel jealous. In response, either sex may try to undermine their rival by disparaging their status or appearance. The author writes that it is important to understand the psychology of sexual jealousy as it’s the leading cause of violence within relationships:

“Male sexual jealousy is the leading cause of the murder of adult women, accounting for between 50 and 70 percent of all such homicides. Police know this. When women are murdered, the prime suspects are boyfriends, husbands, ex-boyfriends, and ex-husbands. Although jealousy sometimes motivates women to murder, only 3 percent of murdered men are killed by their romantic partners or exes, and many of these female-perpetrated homicides are women defending themselves against a jealously violent man.”

I’ll explore my own thoughts about this in more detail in the next chapter. It would be interesting to know how many male on male homicides are motivated by female sexual jealousy though.

Since jealous people in a relationship may feel under threat, they can engage in information gathering as a way to ascertain the source of their feelings and how it may affect them. This action is compared to a gazelle detecting the presence of a predator and becoming watchful and alert to evade danger. Information gathering can range from calling a partner to find out their location, looking through their personal belongings or turning up unexpectedly wherever they happen to be. Dr. Buss conducted studies with newlywed couples and found that both men and women were vigilant in mate guarding. For men, their vigilance was heightened if they perceived their wives as very attractive:

“For example, a vigilant man might introduce his partner to everyone as “my wife” and drape his arm around her when other men are around. Yes, men have a long and sordid history of treating women as possessions.”

But wouldn’t this be the same as a woman clinging to her boyfriend/husband if she saw an attractive woman nearby? Can’t women be as possessive as men? The book doesn’t say. Men who are particularly vigilant may confront and pick fights with men they think may be getting too close to their wife/girlfriend. It’s worth considering here that some women may like men who act in this way although that might have been too controversial to mention in this book. Friends can also be a danger as they are often in close proximity and can share similar interests with couples. As you can imagine, women tend to be more vigilant when their men are high in status since they will likely attract female attention.

Men high in the Dark Triad traits are particularly prone to feelings of jealousy and exhibiting controlling behaviour. They may also create jealousy in their wife/girlfriends by engaging with other women. Jealousy in these men may cause them to yell, threaten, manipulate and even attack their female partners. Women may have adapted tactics to evade men’s mate guarding if it is harmful to them, such as if they are in a controlling relationship. Mate guarding might also disadvantage women because it prevents them from starting another relationship and potentially ‘trading up.’ However, in this scenario, the men in question may be simply trying avoid being taken advantage of by a hypergamous woman.

Tactics women may use to avoid mate guarding include hiding things from their male partner, interacting with other men behind their partner’s back and avoiding places where the women can be checked up on. Women may also avoid ‘public displays of affection’ (PDAs) such as holding hands or kissing in public which signal that they are in a relationship. Women who perceive their male partner as too controlling may also become angry and threaten to end the relationship if it is too smothering.

David Buss also describes another predictor of controlling behaviour from men:

“Which men are most likely to be controlling? Those who are lower in mate value. These men ramp up heavy mate guarding because they believe they have lucked out in attracting a desirable woman and believe that she will be difficult or impossible to replace.”

Men who lack resources will find it difficult to retain a woman, especially if she considers herself more attractive than him, which makes it more likely she will try to avoid being mate guarded. A woman may get out of a relationship by establishing a new relationship then leaving her current one. This is known as “monkey branching” as it’s similar to how a monkey will let go of one branch only after it has grasped another one. According to the author, there have been no scientific studies conducted on men avoiding women’s mate guarding but he believes it is just as common and men likely use the same or similar tactics as women.

Welfare trade-off ratios (WTRs), described in Chapter 3, are a recurring feature in relationships as situations can change which alter it in favour of one half over the other. A high WTR means that you place more value on your partner’s wellbeing over your own whereas a low WTR means you will act more in your own self-interest. WTR can be ‘recalibrated’ so that one half of a couple invests more in the other half thereby increasing it. It has been speculated by psychologists like Aaron Sell that anger is used to increase WTR by making the person who is the target of that anger value the angry person more – this has been called ‘the recalibration theory of anger.’ Essentially, the angry person can prompt the other person in the relationship to try to alleviate that anger and thus invest in them more. The alternative is a downward spiral where both partners distance from each other.

The less desirable partner might also intentionally make their other half jealous by flirting with other people. This is apparently a more common strategy for women than men and common in high Dark Triad individuals. The author notes that invoking jealousy can be a dangerous tactic as it could lead to violence. Although these behaviours are prevalent in unstable relationships, David Buss points out:

“mate guarding is a serious business. In long-term relationships, partners get complacent and take each other for granted. Periodically recalibrating your partner’s WTR can be an important corrective.”

Forgiveness is also used alongside anger and jealousy to alter WTR. If anger is met with one partner increasing their WTR, the other partner may forgive them and stabilise the relationship. This can result in an upward spiral rather than a downward one.

‘The serial-mating solution’ is one alternative to deal with the problems that occur in long-term relationships. Instead of two people trying to stick together despite their difficulties, people may instead move in and out of relationships after they have “outgrown” the other person. David Buss compares this to the different friendships we experience throughout our lives which sometimes last only for a brief period of time. Serial-mating can allow for different experiences but might also make it difficult to form new relationships if you have “baggage” from the previous ones. One example is forming a new relationship after a divorce where children may be involved. The author falls back into feminist mode when he writes:

“Women are especially likely to suffer economic hardship after a marriage dissolves. Compared to men, women experience a greater loss of household income, are more likely to single parent, and are more prone to plunge below the poverty line.”

What isn’t mentioned here is the loss of income that men can suffer from paying child support and not being able, for whatever reason, to see their children.

The chapter concludes by offering another alternative to deal with potential relationship problems: becoming “irreplaceable” to your partner by maintaining mate value in relation to theirs, being more appealing than potential suitors and investing in them and their unique interests.

Chapter 5: Violence against women (and men) in relationships

As briefly mentioned, when taken to extremes, jealousy can culminate in one partner using violence against the other and is one of the causes of “intimate partner violence” (IPV) or what is more widely known as ‘domestic violence.’ As this is a book about “bad men”, most of the focus in this chapter is directed towards male violence against women. Dr. Buss describes how IPV is often thought to be caused by several factors including a pathology suffered by the perpetrator, growing up in a violent household, and gender inequality and the patriarchy. It is noted, however, that IPV is also common in the supposedly non-patriarchal Scandinavian countries so attributing IPV to the latter is insufficient.

Here the book describes how Russian law has no provisions that specifically deal with IPV which is reflected in other countries as well. I’m no expert on Russia’s legal system, but it should be noted that laws against assault and battery are commonplace in many countries and women can presumably use these laws if they are dealing with an abusive partner. IPV is illegal in all US states but is apparently so prevalent that it has to be dealt with at a federal level. Note again though that this depends on the validity of the claims made and what constitutes IPV which, increasingly, has a broad definition. Later it is claimed that IPV increased during the Covid-19 lockdowns but I’ve seen other sources that claim this is dubious.

I found reading this chapter frustrating as it was hard for me to pin down what David Buss’ perception of IPV was in terms of the prevalence of male and female perpetrators. For example, he writes:

“The more serious the abuse… the larger the gender disparity. Most IPV victims who end up in hospital are women. Men’s violence typically does substantially more damage. Every major city has shelters for battered women. In contrast, one of the country’s only shelters for battered men opened in Dallas in the year 2017. Women undoubtedly abuse men, but they generally inflict less damage.”

I knew I was going to write a review of this book so I had a response in my head ready to counter this claim. Dr. Buss, however, seemed to have anticipated a similar response because he suggests that many male victims of IPV are not taken as seriously as females:

“I know of one case in which a man called the police after being badly battered by his wife, his head bleeding profusely from a blow from a frying pan. Upon arrival, the police discouraged him from reporting the crime, despite his obvious injuries: “If she so much as broke a fingernail, you will likely be arrested, not her.” He declined to press charges.”

Later on in this chapter, he also writes:

“Some women do assault their intimate partners, and some researchers argue that female perpetrators are as common as male perpetrators. This research was ignored for many years by scholars partly because male-initiated IPV leads to greater physical injury, but also partly because it contradicted the narrative of “patriarchy” as the primary explanation.”

This at least shows that David Buss wants to be objective as much as he can about IPV so I commend him for that. It has been pointed out to me that since David Buss is an academic, he has to go along with feminist ideas to avoid damaging his career. Anonymous writers like myself and others do not have to worry about this so we have the freedom to express more controversial viewpoints. I still think Dr. Buss genuinely believes some of the feminist rhetoric but ultimately, only Dr. Buss knows what he really thinks.

The book’s focus on female victims is evident by the claim that there is a “strong gender asymmetry” in violence due to men’s greater physical strength, reflected in the previous quotes. This ignores, however, that women can use objects to compensate for their generally weaker physical strength as a way to attack their male partners. Psychological damage, such as feeling emasculated perhaps, is also not considered although this, admittedly, would be very hard to detect and quantify.

One motivation for harming an intimate partner may be as a means to prevent them from leaving – mate retention – and it is claimed that men lacking economic resources are more likely to use violence as a “last-ditch” attempt to retain mates. This link may also be due to the fact that lacking resources or being in financial trouble can cause frustration and distress which increases the possibility of violence.

Another motive for abuse is as a way to control the abuser’s spouse or boyfriend/girlfriend as their self-esteem will decline and they may become dependent on the abuser for their sense of self-worth. For women, in particular, physical abuse will damage their appearance so it is also a way to lower ‘mate value’. An abusive partner may also try to manipulate their other half psychologically by making them think they are losing their mind. This is commonly know as “gaslighting” which takes its name from the play and film Gaslight. Gaslighting allows the abuser to, in David Buss’ words, “zombify” the victim’s mind as they give up their mental perception to the abuser.

Later, Dr. Buss makes a bold and shocking claim about the likelihood of IPV against pregnant women:

“One of the most disturbing predictors of a man perpetrating partner violence is when his partner gets pregnant.”

Women who are abused whilst pregnant are more likely to be carrying a child of another man. A study from Nicaragua found this disturbing feature of violence against pregnant women: attacks directed at a woman’s abdomen in an attempt to abort the foetus. Studies have also found women with children from another man were, according to the book, five times more likely to end up in a women’s shelter. A study of a hundred women in a shelter found that 79% ended up going back to their violent boyfriend/husband for varying reasons. It won’t come as much surprise to find that men with borderline personality disorder (BPD), psychopathy or the other two Dark Triad traits are more likely to commit IPV.

What all of this makes clear is that IPV is more likely to occur in unstable family environments and often without the biological father around. The suggestion that pregnant women are more likely to be abused is a little broad in my view as it doesn’t take into account particular men and women in particular circumstances. The psychological traits of women who end up in violent relationships is also not explored.

After that fascinating – and often dark – exploration of the motives and features of IPV, Dr. Buss falls back into feminist territory by offering the suggestion put forward by Margo Wilson and Martin Daly for the reason for female IPV:

“The main motive for women, they argue, is self-defense or the protection of their children.”

This explanation conveniently makes female violence seem more understandable and sympathetic than male violence. Essentially, women commit IPV for selfless and compassionate reasons, whereas men commit violence for purely selfish and controlling reasons. Margo Wilson and Martin Daly have made some interesting contributions to our understanding of intimate violence, such as their idea of the ‘Cinderella effect’ for example, but this framing of “women’s violence as self-defence” is reflective of the ubiquitous narrative of female victimisation. Steve Stewart-Williams has pointed out that many evolutionary psychologists lean to the left politically which is my view means they tend to be more favourable towards women. I imagine many feminists must have breathed a sigh of relief when an explanation for female IPV like this one became popular so they could hold on to their worldview.

I’m not sure if David Buss has heard of Erin Pizzey (she’s not mentioned in the book), who founded the first modern women’s refuge in the 1970s, but she has stated that many of the women who came to her refuge to escape their male abusers were, in her words “as violent or in some cases more violent than the men they left.” Although Erin Pizzey has noted that there were women at her refuge who were innocent victims of violence, these cases were easier for her to deal with than the more troubled cases where violence went both ways and where most of the problems arise. For her trouble, she received death threats from feminist activists.

Similarly, the writer and former prison doctor Theodore Dalrymple has had direct experience dealing with abused women and, despite expressing sympathy for these women, claimed that many of them were “complicit” in some ways with the abuse they received. Towards the end of this interview, which is worth listening to in full, Dalrymple recalls asking an abused woman where she met her boyfriend and how much time had passed until she got into a relationship with him, to which she replied “down the pub” and “within half an hour.” He also points out that many people would be able to recognise the men who the abused women get involved with as potentially violent and dangerous, and the situation was absurd enough for the woman he was treating to “come in crying and go out laughing.” This doesn’t mean we should automatically condemn women with violence partners, but it does show that IPV cannot be simply presented as being predominantly powerful male perpetrators and powerless female victims.

David Buss cites the case of Francine Hughes as an example of “female intimate partner violence as self defence” as she was a victim of abuse by her husband James. In response, she set their bed on fire while he was sleeping in it and was acquitted on the grounds that she had “temporal insanity”:

“This true story was made into a movie, The Burning Bed, starring Farrah Fawcett as Francine. The movie, hailed as one of the ten best TV movies of all time, helped to draw attention to the pervasive problem of partner abuse and prompted more lenient sentences for women who killed their husbands in self-defense.”

I wonder if it has ever occurred to Dr. Buss, or anybody who read these lines approvingly, that this idea of “temporal insanity” would be a very useful way for women to kill their boyfriends/husbands and get away with it scot-free? James Hughes may well have been a nasty and violent man, but couldn’t Francine Hughes have simply left him and taken the kids? It would likely be argued that Francine Hughes would have been too afraid to leave in case he tried to get her back, but was burning him alive the only choice that she had?

Buss concludes the chapter by steering back towards a more balanced perspective:

“Perhaps some women use IPV for reasons parallel to those that motivate men – to keep a partner faithful, to punish suspicions or observations of infidelity, and to deter the partner from abandonment.”

Perhaps indeed.

Chapter 6: Stalking and conflict after a relationship has ended

Moving on from intimate partner violence, the book explores the issue of stalking which can occur following the break-up of a relationship.

David Buss points out that many of the features of stalking such as giving gifts and showing affection are normal parts of courtship but if such behaviours are not reciprocated than they can lead to trouble. As a crime, stalking is defined as a pattern of repeated conduct that provokes fear in a “reasonable person.”

The author even describes his own experiences of it, as he apparently received unwanted phone calls, cards and gifts from an unknown person at a university he worked for. Since he didn’t feel afraid or threatened, in the legal sense he would not be considered a victim of stalking.

Men are more likely to be prosecuted for stalking than women are. Dr. Buss notes that one reason for this is that women who experience repeated unwanted attention are more likely than men to feel fear over it. This difference could suggest that men are more likely to stalk but it could also be the case that male victims of stalking are simply less likely to report it than women. Since stalking requires persistence and risk-taking, it is possible that it is more of a male phenomenon than a female one.

According to Dr. Buss, exploring the possible evolutionary roots of stalking behaviour provides fresh insights into the psychology behind it. Stalking can take a psychological toll on victims as they may be subjected to threats of assault which a stalker may follow up on. As many stalkers can be ex-boyfriends or husbands, they may have expressed feelings of intense jealousy during the relationship reflecting what was discussed in Chapter 4. In extreme cases, stalking can lead to murder. An example given is the high profile case of OJ Simpson and the murder of his ex-wife Nicole Brown. Prior to her murder, Simpson had apparently stalked her and was intensely jealous during their relationship. As far as I understand though, OJ Simpson has never been confirmed as the culprit to her murder although his DNA was infamously found at the scene of the crime.

Experts of stalking have stated that threats can generate more distress than actual physical harm because the “looming vulnerability” that results from threats can cause great psychological disturbance. While I’ve never been stalked, I have some experience of dealing with threats and being vulnerable from when I worked in a mental health hospital and so can attest to this claim. Although the people I worked with were not extremely violent, some of them suffered from mood swings and could suddenly become aggressive towards others without any provocation. The harm I received was fairly minor but what was worse was not knowing when or how bad the aggression was going to be so beforehand I was often felt very tense and nervous. Therefore, I can understand in some way how victims of stalking may feel. Acts of violence from stalkers are also more likely than threats to generate a response from law enforcement which may explain why the latter causes more psychological stress.

As well as violence, stalkers may try to harm their victim’s reputation or target their friends, family members and pets. In some cases, victims of stalking may relocate or avoid socialising to deal with a stalker. I found a lot of this chapter very interesting as it explores the common psychological features of people who may engage in stalking. There are parallels with those who may commit IPV, such as having a psychological disorder or being insecure about attachment:

“According to attachment theorists, those with an insecure attachment style distrust intimates, fear rejection, and show a heavy emotional dependence on a partner. They have poor social skills and become overly clingy with romantic partners. Ironically, their fear of rejection is entirely warranted.”

Since overly attached people can become overbearing, they can inflict a “heavy relationship load” on their partners which increases the chances of the relationship ending. This rejection will obviously make the overly attached person distressed and potentially unstable. One study found that people who scored high on being insecure about attachments had a stronger proclivity to stalk. Another study showed that convicted stalkers tended to be high on the autism spectrum disorder scale which suggests that they are often poor at reading or understanding the intentions or motivations of the object of their attention. Some stalkers also have borderline or narcissistic personality disorder. These findings may explain why a lot of stalkers do not consider their behaviour to be harassing or intrusive. They believe they are just expressing interest in those they stalk and may misinterpret rejection as a test of their commitment. Other stalkers, however, may target people as a form of revenge or before attacking them – sexual predators for example.

The motives of stalkers are commonly linked to mating psychology and the most frequent of this type is the “rejected stalker”: someone who stalks their ex after their relationship has ended. Stalking behaviour might begin just before a break-up as a form of mate guarding and retention as explored in the fourth chapter. In one study, 32 percent of stalking cases were motivated by jealousy and distrust of a partner. Rejected stalkers are thought to be primarily motivated by rage and humiliation which is a way of recalibrating WTR (as explained in Chapter 4) and dealing with a decline in mate value which may affect their reputation. The rage the rejected stalker feels towards their ex may lead to the ex restarting the relationship although this is very rare.

Female victims of stalking are more likely to be young and of reproductive age and, like with IPV, more likely to be victimised by men older than them. One reason for this may be that such women are less aware of their desirability and also less experienced in relationships which may mean they form relationships with men lower in mate value than them. The men in these situations may believe that their chances of forming a new relationship are lower than their current girlfriend/wife’s:

“the stalker, being lower in mate value than his expartner, realistically perceives that it will be difficult or impossible to replace her with a mate of comparable value. “Since she loved me once,” he thinks, “perhaps I can win her back.””

Victims might receive threats of violence such as “if I can’t have you, no one can.” In addition to violence, some stalkers might also attempt suicide and self-harm to keep their partner in their life. Less extreme actions can cause distress to targets of stalking even though they appear innocuous to others, such as a stalker watching their ex from afar. All these behaviours can result in exes not forming new relationships for fear of harm coming to their new partner.

David Buss acknowledges that it would seem illogical to suggest that stalking behaviour is an evolutionary adaptation since it often has the opposite effect to what stalkers desire. However, it could succeed over countless instances across time and there are situations where it has succeeded, if only temporarily. Dr. Buss studied over two thousand stalking victims and found that 30 percent of female victims met stalkers on their request and 6 percent even had sex with them! Stalking can be successful from the stalker’s perspective as victims may devote a lot of time and energy dealing with the ramifications of such behaviour preventing them from living their life as normal. On a psychological level, stalkers “hijack…victim’s psychological space” so they can’t think about anything else. Victims engaging with stalkers in an attempt to stop their harassment can lead to stalkers controlling their victims by “rewarding” them by stopping and then stalking again to punish them.

Another form of stalking or revenge after a break-up has emerged with modern technology: revenge porn. This is where photos or videos of an ex that are erotic or pornographic can be distributed online to embarrass and provoke an ex for ending the relationship. Revenge porn can also lead to complete strangers stalking the victim. One motivation for revenge porn may be to coerce exes into resuming a relationship with the stalker or just have sex with them. Revenge porn can be particularly harmful to women as it affects their “sexual reputation” which men care more about than women for reasons already mentioned in this review.

David Buss and his colleague Joshua Duntley have developed a website to help victims of stalking which can be viewed here. He also offers tips to help victims of stalking at the end of this chapter. These include seeking support from friends and family, stopping all contact with stalkers since they find this rewarding, and documenting the stalker’s actions to increase the chance of prosecution.

Part 3 will conclude this review and deal with the often controversial subject of sexual coercion which covers sexual harassment and rape.

Book Review: ‘Bad Men: The Hidden Roots of Sexual Deception, Harassment & Assault’ by David M. Buss (Part 1)

Bad Men by David Buss | Hachette UK
2.5/5 stars

Overview: David Buss’ book is interesting, but is ultimately let down by falling into feminist thinking and talking points.

I bought this book on a whim after reading a review of it on the website Aero by William Costello. What interested me was not so much the review itself but the comments underneath it which were critical of what Mr. Costello had written and the details of the book. One of the commenters was Steve Moxon, author of the book The Woman Racket who has done his own research and studies into human sex differences that goes against the feminist narrative. The general feeling in the comments was that, despite Aero claiming to challenge conventional thinking, the book and reviewer basically upheld the status quo idea that male violence against women was widespread and society had to find ways of dealing with it.

I concurred with the comments under the article but I was intrigued enough to read the book myself and draw my own conclusions. I believe both William Costello and the book’s author, David Buss, want to be impartial and objective in this discussion but they may be too entrenched in academia to challenge the current consensus and present an alternative or opposing viewpoint. William Costello appears to be sympathetic and open-minded regarding issues affecting men but I still differ in some ways from his point of view.

David Buss is a prominent evolutionary psychologist working at the University of Texas in Austin whose career began in the 1970s and has written books such as The Evolution of Desire and The Murderer Next Door. Bad Men is the first book I’ve read by Dr. Buss which explores sexual conflict between men and women and the psychology of male perpetrators of sexual violence in particular.

For whatever reason, the book has been published under two different names as it has also been published with the title When Men Behave Badly which also has a different cover. Bad Men is the UK title.

Chapter 1: Biology and sexual conflict

David Buss begins by explaining that sexual conflict between men and women is rooted in “evolved sex differences” in sexual psychology. This is related to the distinctive gametes that men and women uniquely possess. For more information, you can read my description of Chapter 3 of The Ape That Understood the Universe. One of the most obvious differences between the sexes, to everybody except trans fanatics at least, is that women get pregnant and men do not. This means that women bear potential metabolic costs after sexual intercourse which men don’t since men can successfully reproduce just by impregnating a woman. In other words, in terms of reproduction, men are the ‘outsiders’ and women are the ‘insiders’ which means they both have advantages and disadvantages in the domain of sex and reproduction. Dr. Buss believes an “evolutionary lens” helps identify when sexual conflict may occur between men and women and says one goal of the book is to highlight circumstances that may increase or decrease its likelihood.

It is pointed out in the first chapter, titled ‘The Battle of the Sexes’, that the increasing conflict surrounding men and women has been blamed on many things from the patriarchy and toxic masculinity to feminism. David Buss even addresses the ‘manosphere’ writing:

“Manosphere bloggers… blame women who seek sex with “alpha chads” (high status males) and exploit lower-status males who are “betas” for their investment.”

I don’t know if I meet the definition of a ‘manosphere blogger’ but David Buss’ perception of the manosphere seems to focus on one area of a very large and loosely connected group(s) rather than encapsulating the whole of it. The issue of hypergamy, which Dr. Buss is basically referring to, is more of an interest of certain groups of men who arguably make up the manosphere, such as incels but not only them, whilst other so-called manosphere bloggers may be focussed on issues such as family court bias or misandry in general. David Buss does acknowledge that women are attracted to men with high power and status but writes:

“Missing from these manosphere accounts, however, is that women’s mate preferences are enormously complex and include qualities such as honesty, intelligence, dependability, moral character, sense of humor, and many more.”

Again though, other figures in the manosphere may agree with this statement and be more interested in other topics relating to men.

The author also considers the feminist idea of patriarchy as the source of conflict between the sexes but argues against it by stating, in his opinion, that both sides – that is, feminists and the manosphere – fail to recognise biology and how it relates to the modern world. David Buss essentially argues for a ‘centre ground’ as a way to understand male-female sexual conflict. However, this isn’t entirely true as many of the individuals who have influenced my thinking and consider themselves part of the manosphere have read about evolutionary psychology themselves.

Likewise, in his attempt to strike a balance between feminism and the manosphere, Dr. Buss states:

“Patriarchal institutions such as laws that give husbands control over their spouses’ sexuality for example are still on the books in some countries and have lingering pernicious effects in others.”

This is clearly to appease any feminists who could be reading and might be troubled by his accusing them of denying biology. The problem here though is that Dr. Buss states a feminist position but doesn’t give any alternative theories why such institutions and laws exist other than an apparent male desire to control women. Unlike the arguments by bloggers in the manosphere, this is presented as self-evident and something that does not require further scrutiny. Undoubtedly, men in some countries may use particular laws as a means to oppress women, but the motivations behind ‘patriarchal’ laws, in Western countries at least, are partly to deal with the aforementioned fact that men are the outsiders of reproduction and their role in their children’s lives can be diminished if these laws are altered without thinking about this. These feminist-influenced statements are a recurring feature of the book so I’ll explore this a little more later.

Here the book takes a more interesting detour into sexual conflict in other species, for example, spiders of the family Pisaura mirabilis and how they interact during courtships. Typically, the male engages in the arduous task of capturing an insect and offering it as a gift to the female to initiate mating. This isn’t always straightforward, however, as a number of scenarios can occur such as the female taking the gift and leaving without mating with the male or the male wrapping something worthless in silk and mating with the female while she unwraps the gift.

I found this description darkly amusing in a way and we can probably think of human examples that are not dissimilar! Other examples of sexual conflict amongst insects in particular include water striders of which the males have penile spines which can damage the female’s reproductive tract. Another more well known example is the female black widow spider which can consume the male after mating.

Buss then writes about men and women being in a ‘sexual conflict co-evolution’ whereby one sex develops a tactic to exploit the other sex resulting in the latter developing an evolved tactic to avoid the exploitation. This is compared to predators like cheetahs evolving tactics to capture prey like gazelles which, in turn, evolved a response against it – i.e. both use speed, habitat, vigilance, etc. to prey on or avoid being preyed on by the other. In terms of men and women, Dr. Buss writes:

“adaptations in women to avoid subpar males or to require extensive courtship displays before consenting to sex have created selection pressures on men to circumvent these barriers. Defensive adaptations to deflect sexual advances are countered by sexual persistence adaptations.”

One problem I have with this argument is how closely this falls into the now standard narrative of ‘female victims’ and ‘male perpetrators’. Using the predator-prey analogy makes this more likely and discourages interpreting sexual conflict in other ways. We could just as well interpret the ‘battle of the sexes’ as a form of ‘one-upmanship’ in which each sex simultaneously takes advantage and is taken advantage of. The previous example of the male and female Mirabilis spider illustrates this idea more than the cheetah vs. gazelle one.

A notable ‘battleground’ where sexual conflict can arise is the differing sex drives between men and women. As women’s sex drive is generally lower than men’s, ‘female choosiness’ comes into play which inevitably creates tension, misunderstanding and potentially violence. The often cited statistics about online dating sites are presented which show that most men rate most women as attractive whereas women rate only around 20% of men as attractive. One reason for female choosiness is of course because women face costlier consequences if they have sex and become pregnant. The author notes that men and women tend to differ in how soon after meeting they desire to have sex, with men desiring it earlier than women:

“1 scientist analogized this to having 2 pairs of hands on the same steering wheel of a car, each having a somewhat different destination, each trying to turn the wheel towards its own destination but being forced to contend with pulls from the other.”

To manage these biological realities, many civilisations have found unique ways to order relations between the sexes. The book describes how men in the Tiwi tribe, a group from an island near Australia, use women and girls like currency by bestowing them to other men at birth. When the girls reach adolescence, they move in with their bestowed husband. Men who are given women as brides can reciprocate by offering their own daughters in return. If this sounds highly demeaning and exploitative towards women, it’s worth noting that this system results in a lot of young men without any women whilst a small group of older men have three or four. Also, many of the younger women can become widows when their older husband dies and may have a say in their next husband. Not surprisingly, there is also infidelity between young brides and younger men and the tribe have found their own ways to manage this. Although this is an extreme example, it shows that women are often a resource that men compete for.

Regardless of men’s desire for more sex and with more partners than women, men also face costs which can lead to sexual conflict. The most obvious is that they could be a victim of ‘paternity fraud’ – i.e. a man can unknowingly acknowledge and raise a child that isn’t actually his own. This is not only costly in terms of mating opportunities, but also in time, resources and possibly psychological damage. This can lead to ‘sexual jealousy’ in which men are suspicious about women’s sexual activity and proximity to other men. To manage this, men may engage in ‘mate guarding’ by monitoring women’s activity and location. The book describes an app available in Saudi Arabia called Absher whereby men can track their wives’ movements! It is also noted that this suspicion from men hasn’t altered even though many women use contraceptive pills to prevent getting pregnant.

The restrictive practices towards women in countries like Saudi Arabia is contrasted here with a tribe in Brazil called Yanomamo in which men spend a lot of time away from their wives hunting for big game. This means that women have more influence to make decisions as they are not ‘guarded’ by their husbands. This is interesting considering that this kind of arrangement is more or less identical to traditional hunter-gatherer societies or, more recently, the traditional gender roles of men going out to work and women staying at home. We are often told that women were oppressed in this situation but if women’s husbands were away at work most of the time, doesn’t this mean women had the same freedoms as Dr. Buss argues Yanomamo women have? We could draw two conclusions from this: either, feminism falsely portrayed women staying at home as oppressed or, feminism naturally developed from this environment, particularly as technological advances reduced women’s dependency on men for resources. I actually think both are true even though they appear contradictory.

Other sources of conflict include men’s superior size and strength, the proximity of friends and family or ‘allies’ and the choice of potential partners available to either sex. In addition, individual differences can determine the likelihood and severity of sexual conflict occurring. For example, people who score highly on the so-called ‘dark triad’ traits of psychopathy, narcissism and Machiavellianism are said to be more likely to be sexual exploitative. I’ll explore this in a little bit
more detail later.

Given the topic of this book, most of the exploration of sexual conflict focusses on male perpetrators and female victims but, to his credit, Dr. Buss states:

“Can women be sexual predators? Our research on the Dark Triad suggests yes, but in somewhat different ways. Women who score high in Dark Triad traits are more likely to engage in mate poaching, luring men away from existing relationships for sexual encounters. High scoring women are also more likely to use sex as a tactic for getting ahead in the workplace.”

Chapter 2: Attraction, Dating and Mating

In the second chapter: ‘The Mating Market’, David Buss argues that conflict arises between the two sexes due to them pursuing different mating strategies. In addition to men having a higher sex drive, they also have a greater desire for sexual variety. This has been shown not only across cultures, but in homosexual men as well (see Chapter 3 link for more details).

According to the book, men also overestimate their attractiveness in the mating market and have higher self-esteem than women. Men also appear to have a ‘sexual over-perception bias’ in which they perceive sexual interest in a woman that is not actually there. Men might also underestimate how upsetting their actions are towards women. In my view, I can’t help thinking that men simply assume women are as attracted to them as vice versa. However, in the event of a low risk casual encounter, men may lower their standards. It is pointed out that both men and women attempt to secure a partner on dating sites who is 25% more desirable than them.

What explains this behaviour? One explanation is female choosiness. Here the author writes:

“‘Men are one long breeding experiment run by women’ according to some evolutionary anthropologists. Men have evolved to be fiercely motivated to acquire the resources and status women desire in a mate and to embody the qualities women want, such as kindness, dependability and physical fitness.”

Note that survival is also an effective motivator for acquiring resources and status as well as the traits mentioned if only to work in a group or evade conflicts. Women could simply be more receptive to traits that would aid survival, which is something both sexes desire. In other words, men’s motivations for obtaining status and resources might not just be motivated by female approval.

Much like the spiders described in the first chapter, both sexes try to find short-cuts to attract the opposite sex. Men may deceive by posing next to expensive cars, wearing expensive items of clothing, or even posing with attractive women in order to impress other women. Women may deceive by ‘catfishing’ whereby fake photos of an attractive woman are presented on a dating site and then used to fraud the victim in some way. Indeed, Dr. Buss writes:

“Neither sex has a monopoly on deception. One study found that an astonishing 81 percent of online dating profiles contained at least one lie about a verifiable characteristic such as age, height or weight.”

The book veers into more feminist-tinged territory with the idea that men are particularly attracted to women deemed to be ‘exploitable’, reflecting that perpetrators will target people they consider to be more vulnerable. This is true not just for sexual assault but for many crimes. Traits that favour exploitability include low intelligence and being younger. Evidence of this purportedly comes from men perceiving women who are intelligent as attractive in a long-term relationship but not in a more short-term scenario.

I don’t entirely agree with this argument about intelligence and exploitation as it is possible for somebody to be intelligent but also naïve and suggestable – especially younger people. While it’s true that more intelligent people will be better equipped mentally to avoid being taken advantage of or manipulated, a young, educated woman from a protected, privileged background may be less prepared to deal with certain kinds of men than a less educated, less intelligent woman from a poorer background who may have experience of predatory, exploitative men. This is the difference between a woman who is ‘booksmart’ and a woman who is ‘streetsmart’.

Alcohol consumption is another way in which women can be vulnerable; it is easier for them to get drunk as they have less of the enzyme alcohol dehydrogenase than men. It is not pointed out in the book, however, that people individually, and regardless of sex, can differ in how much alcohol they can consume before becoming drunk as some men can be classed as ‘lightweights’ and so can equally be exploited. Here again, the book presents women as poor, helpless victims and men as potential predators and perpetrators. Dr. Buss writes:

“Because alcohol stimulates bonding endorphins, women are more likely to misread interactions and relationships with men when intoxicated. They overestimate the likelihood of an emotional bond and a long-term relationship – what Dr. Andy Thomson calls the Prosecco perception bias.”

Since alcohol affects our judgement and increases our impulsivity, which would favour short-term desires over long-term ones, I’m not entirely sure how accurate that statement is, but it’s perhaps not a good idea for women, or anyone, to believe that they’ll make sound decisions whilst drunk. A good piece of advice to women would be to watch how much they are drinking so they are less likely to find themselves in unfortunate situations. This may nowadays be misconstrued as victim blaming.

David Buss continues the ‘female victim, male perpetrators’ perception by describing male college students drinking as “high testosterone, alcohol-fueled men” as if they are big bad wolves preying on Little Red Riding Hoods. But if young college women were so vulnerable and afraid of their male peers, they would never go out at all.

In reality, women can take advantage of sexually aroused men just as some men may take advantage of women. The author concedes this, noting that women can benefit from short-term mating via access to resources, but describes them as “exploiting the exploiters” as if such women are simply retaliating towards male offenders.

Indicative of what could be called ‘feminist thinking’, Dr. Buss writes:

“Women’s manner of dress does not excuse men legally or morally from being guilty of sexual exploitation, although historically it has been misused by defense lawyers for this purpose.”

But this depends on what we would define as ‘sexual exploitation’, such as if a man and a woman had mutually consented to sex or not. A woman who dresses a certain way, particularly on a night out, is inviting certain attention from the opposite sex even if she may not consciously intend to do so. If she is sexually assaulted, it doesn’t mean that she ‘deserves’ to be, but dressing in certain ways will generate responses she may or may not want. Is it wrong to expect women to have some responsibility over this?

The book turns to the more interesting topic of women’s attraction to men high on the aforementioned ‘Dark Triad’ traits (psychopathy, narcissism and Machiavellianism) which is called the ‘bad boy paradox’. This is apparently evident in dating profiles as such men are rated higher by women than men lacking in these traits. One explanation for this is that Dark Triad men are often charming and confident which conveys high mate value. This makes sense as this is what women find attractive in men in general. These traits would have also benefitted men in surviving our more chaotic and unstable ancestral past. Women who mated with such men may have passed these traits on and had ‘sexy sons’ who passed them on as well. However the author notes:

“The hypothesis would have to pass a high empirical hurdle, because these reproductive benefits would have to outweigh the costs that women vulnerable to high-level Dark Triad men are known to suffer.”

The phenomenon and the possible explanation behind it make sense to me, but I still have issues with how personality traits like the Dark Triad are ‘measured’ by psychologists, since they appear to be based on a subjective assessment. It is hard to imagine people high in psychopathy, narcissism or Machiavellianism being willing and able to give an accurate evaluation of themselves, in much the same way that it would be hard for a compulsive liar to admit they are a compulsive liar. It wouldn’t be surprising, after all, if compulsive liars were high on the Dark Triad traits! I doubt a genuine psychopath, if asked if he was psychopathic, would reply: “Why, yes. Yes I am” although this of course is an extreme example.

In this section, some of the statements used as measurements of the Dark Triad traits, which people are asked how much they agree with, are presented. Nevertheless, a lot of these statements are, in my opinion, hints of the traits at best.

For psychopathy, the statements presented include: ‘payback needs to be quick and nasty’, ‘people who mess with me always regret it’ and ‘I like to pick on losers.’ Whilst these statements correlate with psychopathy, I think you could agree with these without necessarily having psychopathic traits. For me, the closest example to a psychopathic mindset given is ‘I’ll say anything to get what I want’.

Similarly, statements measuring narcissism include: ‘I like to be the centre of attention’ and ‘I know that I’m special because everyone keeps telling me so’. While these are certainly how a narcissist might think, I don’t know if a genuine narcissist would be so self-aware, or so honest and self-critical, to agree with them. For Machiavellianism, statements provided include: ‘It’s wise to keep track of information that you can use against people later’ and ‘make sure you plan benefits you, not others’ which might hint at the trait but, to me, needs to be more specific to be an accurate assessment.

Chapter 3: Trouble in paradise

In Chapter 3, the book delves into the conflicts that can arise after a relationship has been established. Any long-term relationship inevitably has its struggles and conflicts as couples have to live together and face life’s trials and tribulations.

In the case of sexual conflict, one problem that can present itself is the changing desirability or ‘mate value’ of one partner relative to the other as nothing remains static. As people grow older, they may become less attractive to their partner and face competition from younger suitors. Situations can also change and make one partner more attractive and, crucially, more attractive to others. The case of Dorothy Stratten, for example, highlights what can happen when someone’s mate value increased to the detriment of their partner. She became an actress and left her husband Paul Snider for the director Peter Bogdanovich in a classic case of ‘trading up’. In response, Snider murdered her and then killed himself.

According to the book though, even stable and committed relationships can cultivate people who act as ‘back-up mates’ in case the relationship turns sour or suddenly ends due to death or other circumstances. These back-up mates can turn into affairs and Dr. Buss notes that men and women may pursue affairs for differing reasons. As already stated, men may pursue an affair or affairs to satisfy their desire for sexual variety whereas women may have an affair to obtain a ‘better’ partner. David Buss writes:

“women are more likely to cite emotional involvement as a reason for the affair. Men are more likely to cite pure sexual pleasure.”

It is also claimed that women are more likely than men to fall in love with the person they are having an affair with. While it is not stated in this book, this is basically the principle that ‘women want love and men want sex’ which is a conclusion that a lot of people come to. In my opinion, this is a flawed assumption. The reason I believe this is because of the declining marriage and birth rates that have accompanied ‘women’s liberation’. Additionally, there has been a rise in births outside of marriage and the growth of areas described in one report as ‘men deserts’ in many towns and cities.

This is in no way to say that these developments are all women’s fault, but if most women naturally desired long-term relationships, wouldn’t giving women ‘more control over their bodies’ result in them choosing men who also wanted long-term relationships? Also, why did societies in the past stigmatise women who had children outside of marriage or without a father around? The feminist answer would be because of ‘patriarchal oppression of women’ but the plausible answer would be that without these stigmas, some women would have chosen to have sex and get pregnant without thinking of the consequences. These women are now usually provided welfare in place of a husband meaning they are, effectively, ‘married to the state.’ It is likely there were women in these circumstances who didn’t deserve to be shunned, but these attitudes must have emerged for a reason.

To be clear, I don’t believe men in these situations were always innocent and blameless. It is important to point out that men who impregnated and abandoned women were stigmatised as well so this is not about ‘female victim blaming’ or misogyny.

According to Michelle Langley in her book Why Women Cheat, although women claim they want an emotionally involved man, they may in fact pursue men who are not interested in them, at least not in the romantic sense, as this creates tension and excitement which may link with women’s attraction to ‘bad boys’. In contrast, a man who openly shows his love for a woman may appear needy and too dependent on them. Obviously, many women also desire love and commitment from men but this shows that, in both sexes, there is often a disconnect between our sexual desires and our romantic ones. The author does point out though that women who have affairs may also score high on the Dark Triad traits.

Returning to the book, Dr. Buss writes that humans have evolved strategies to switch mates if needed in response to environmental changes:

“we come from a long and unbroken line of ancestors who went through mating crises – ancestors who monitored mate value, tracked satisfaction with their current unions, cultivated backups, appraised alternatives, and switched mates when conditions proved propitious.”

Mate value can be thought of as a balance between the value one person places on themselves and the value they place on their partner. This is called a ‘welfare trade-off ratio’ or WTR. If WTR is balanced then the relationship is likely to be stable and healthy as neither person is self-centred nor entirely dependent on the other person. In long-term relationships, mate value may change suddenly or regularly fluctuate. An example given is women’s ovulation cycle which may make them more attractive due to physical changes like a lower waist-to-hip ratio.

The so-called ‘double standard’ in attitudes towards sexual infidelity might also be a source of conflict. Generally, people consider women cheating on a man as worse than a man cheating on a woman which some women consider to be wrong. The author states this is partly due to men’s desire for sexual variety but does not mention that another reason is that men reasonably fear paternity fraud if they discover their wives have cheated on them with another man although he mentions this earlier in the book. There is also a ‘me versus thee’ double standard in that people tend to judge their partner kissing, performing a sex act or having sex with someone else more harshly than they would if they did it.

The final source of conflict covered in this chapter is sexual withdrawal which is usually thought of as done by women as a way to control men. This is true, but Dr. Buss points out that men can also do this to women. Many cultures expect there to be sexual relations in marriages so one person denying their other half sex, or having sex with somebody else, is obviously considered to be wrong. Historically, adultery committed by women was considered a ‘property violation’ of one man against another which suggests to some that this was a form of patriarchal oppression of women. David Buss falls back into feminist thinking when he writes:

“the male sexual psychology that gave rise to the laws to begin with – specifically male sexual proprietariness – continues to be fully activated within committed relationships. Cultural
shifts towards greater gender equality within relationships have dramatically reduced men’s entitlements. Western marriage no longer grants men unconstrained sexual access whenever and wherever they want. Women within committed relationships have the rights and freedoms to consent to sex or to withdraw sex. And this gives women a critical lever of power – the power to reward and the power to punish.”

This implies men created such laws as a kind of ‘ego trip’ to exert power over women rather than to deal with many of the conflicts David Buss described in this chapter. Since men are the outsiders of reproduction, their relationship with their children can be threatened if women are not honest about their sexual discretions, and many men would assume that their wives want to have sex with them and would, understandably, be suspicious if they didn’t – over the long-term at least. Withdrawing sex may allow women to get what they want but this can also create resentment as the man might emotionally withdraw. As already mentioned, men can also withdraw sex which can lead to women fearing the relationship is falling apart or there’s another woman involved.

Underlying many of these relationship conflicts is feelings of jealousy which is explored in the next chapter.

To be continued…

MMM#10: All You Have Is Now

All of the self-help type stuff I’ve written on this blog is as much for my own sake as anybody who chooses to read it. I’ve always been obsessed with self-improvement and productivity even though I’ve often failed at both of these things. At the end of last year, I set myself some targets to accomplish during this year such as posting at least twice a month and writing at least five book reviews. Even though it’s only the first month of the year as I write this, I feel like I may not be able to achieve most or all of these targets! This is one of the problems with planning for the future as it’s hard to tell what will happen when the future becomes the present.

It we consider the years 2024 or 2025, which are only a couple of years in the future (thus dating this post fairly quickly), it can seem like they are filled with endless potential and possibilities. When they come around though the same issues that face us in the present will emerge and whatever thoughts and plans we had about it will become limited. It’s true that a lot can change by then, but we still have the then-present to contend with.

The psychologist Jordan Peterson has developed a self-authoring program which allows people to plan out their life in the future as well as write about the past and present. This program has apparently helped many people to achieve their goals and reduce anxiety. There’s nothing wrong with planning for the future but there may be drawbacks to this approach too. You could potentially set yourself up for a fall by setting targets for a later date because you don’t know what may happen to you between now and that later point. It’s also possible that you frustrate yourself if you don’t manage to achieve the goals you set for yourself. You also don’t know what your situation may be in the near future as your mood can change depending on the circumstances.

Depending on your temperament, you might worry more about the future than other people and become fixated on accomplishing something by a certain date at the expense of other things. If you fail, then your worries were for nothing.

Since we only live in the present, it’s important that we focus on what we’re doing now as well as paying attention to what we hope to do in the future. Why waste time worrying about what you haven’t done or had wanted to do if nothing comes of it anyway? Could whatever you happen to be doing right now be done better? While focussing too much on the present could lead to short term thinking and instant gratification, I think if you look at what you’re doing now as well as look at what you’ve achieved and what you hope to achieve, you can maintain your productivity. In short, you should try to look at the past, present and future but remember that you only live in the present.

I’m still going to try and achieve the goals I set for myself, but will also try to focus on the present and not dwell on the future too much since the future will turn into the present very soon.